We narrowed to 1,564 results for: CAG promoter
-
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBASceI
Plasmid#26477PurposeI-SceI endonuclease expression vector with mammalian promoter to introduce a DSB at a genomic I-SceI siteDepositorInsertpCBASceI
TagsHAExpressionMammalianAvailable SinceOct. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-gfaABC1D-mCherry-CAAX
Plasmid#218189PurposeTo over express mCherry-CAAX under gfaABC1D promoter in astrocytesDepositorInsertmCherry-CAAX
UseAAVExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pISV-CRISPR/Cas9PGmUbi
Plasmid#209189PurposeExpression of Cas9 in the model legume Medicago truncatula, Gmubi promoter (PGmubi), DsRed and Basta selectionDepositorInsertsCas9
DsRed(deltaB)
TagsNLSExpressionPlantMutationmissing BsaI site and plant-codon optimized with …PromoterCaMV 35S and GmUbi from Glycine max (L.) Merr. cv…Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgfaABC1D-mCherry-CAAX
Plasmid#196488PurposeTo over express mCherry-CAAX under gfaABC1D promoter in astrocytesDepositorInsertmCherry-CAAX
UseAAVExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-T_RFP entry
Plasmid#87526PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-A_RFP entry
Plasmid#87527PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-C_RFP entry
Plasmid#87528PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-G_RFP entry
Plasmid#87529PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-PrPro
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN262
Plasmid#91607PurposeExpress sgRNA targeting human EPHX2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
INS-CRa-Lsg-MS2
Plasmid#247478PurposesgRNA for INS activation cloned into LsgRNA-MS2 backboneDepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCrx-DsRed
Plasmid#13765DepositorAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDF0428 huDisCas7-11-R1045-GGGS-R1122-U6-pro-Gluc
Plasmid#186985PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, Gluc crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pRSETB
Plasmid#55775PurposeGenetically encoded caged Ca2+DepositorInsertPACR
Tags6xHis and msEGFPExpressionBacterialPromoterT7 promoterAvailable SinceJuly 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCX-H2B-KikGR
Plasmid#98649PurposeExpresses a nuclear-localized photoconvertible green-to-red fluorescent proteinDepositorInsertKikGR
TagsH2BExpressionMammalianPromoterCMV-IE enhancer chick beta actin promoterAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY_gRNA_hPAX7-Pro_C3
Plasmid#160454PurposesgRNA targeting human PAX7 promoterDepositorInsertgRNA_hPAX7-Promoter_C3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
phU6 ST
Plasmid#188712PurposesgRNA plasmid encoding hU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 ST
Plasmid#188713PurposesgRNA plasmid encoding mU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 ST
Plasmid#188715PurposesgRNA plasmid encoding hH1 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-miRFP703-dSal-VP16minADx3-hCRY2-NLS
Plasmid#241843PurposeExpresses an actuator of Opto-p53 in mammalian cells.DepositorInsertVP16
TagsCRY2 and miRFP703ExpressionMammalianMutationVP16 minimal activation domain x 3PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-Nluc
Plasmid#192657PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-NlucDepositorInsertNluc
UseLuciferaseExpressionMammalianPromoterU6, miniCMVAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmU6 NFATC2
Plasmid#188709PurposesgRNA plasmid encoding mU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY105
Plasmid#130939PurposeEngineered sgRNA-LEA3 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA3
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
PBMBP-eGFP
Plasmid#40976DepositorInsertMBP promoter fragment (Mbp Mouse)
ExpressionMammalianAvailable SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only