We narrowed to 1,634 results for: CAG promoter
-
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1802_pmax-RBFOX1N-dCasRx-C
Plasmid#118635PurposeTransient transfection; Expresses RBFOX1N-dCasRx-C; CAGGS promoterDepositorInsertRBFOX1N-dCasRx-C
UseCRISPRExpressionMammalianPromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-opa1 guide
Plasmid#121995PurposeAn entry vector with U6a and U6c promoter driving opa1 guide RNAs expressionDepositorInsertopa1 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPN283
Plasmid#91666PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHes1-DsRed
Plasmid#13767DepositorInsertHes1 promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNrl-DsRed
Plasmid#13764DepositorInsertNrl promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4404
Plasmid#115465PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL1-3964
Plasmid#115459PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-1
Plasmid#193699PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh5
Plasmid#127651PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2911
Plasmid#161764PurposeMODULE C plasmid compatible with the Voytas Plant Genome Engineering Tool kit with an Agrobacterium promoter rolD expressing the TREX2 exonuclease.DepositorInsertrolD:TREX2
ExpressionBacterialPromoterrolDAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-Fgf5Pro
Plasmid#227479Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-tdTomato
Plasmid#159275PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven tdTomato cassette (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInserttdTomato
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-puro
Plasmid#65230Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-neo
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEMS2050
Plasmid#49135PurposeAAV plasmid with CAGGS promoter driving expression of EmGFP.DepositorInsertssAAV-CAGGS-emGFP
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1988
Plasmid#49119PurposeAAV plasmid with CAGGS promoter driving expression of iCre.DepositorInsertssAAV-CAGGS-iCre
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1989
Plasmid#49120PurposeAAV plasmid with CAGGS promoter driving expression of iCre. Contains WPRE.DepositorInsertssAAV-CAGGS-iCre-WPRE
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2058
Plasmid#49136PurposeAAV plasmid with CAGGS promoter driving expression of EmGFP. Contains WPRE.DepositorInsertssAAV-CAGGS-emGFP-WPRE
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cas9 MDC123
Plasmid#59184Purpose2x35S promoting Glycing Max codon optimized Cas9 with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoter2X35SAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
G10 Cas9 MDC123
Plasmid#59187PurposeG10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoterG10Available SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_B
Plasmid#72626PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_B
Plasmid#72621PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRho-Cre
Plasmid#13779DepositorInsertRhodopsin promoter-Cre
UseCre/LoxTagsMycExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC25A39-2
Plasmid#251688PurposegRNA to knock out SLC25A39 in mammalian cellsDepositorInsertSLC25A39 solute carrier family 25 member 39 (SLC25A39 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
TagsHA and YFP (Venus)ExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Blasticidin XLone-eGFP
Plasmid#159754PurposeAAVS1 donor plasmid for targeted inducible eGFP expression in human cellsDepositorInsertall-in-one tet-on system
UseCRISPR and TALEN; Donor plasmid for targeted knoc…ExpressionMammalianPromoterTRE3GS inducible promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-FLAG-AT2R-CFP
Plasmid#101660PurposeExpresses AT2R with FLAG tag and CFP in mammalian cells.DepositorInsertAngiotensin II type 2 receptor (AGTR2 Human)
TagsECFP and FLAGExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
PBGFAP-eGFP
Plasmid#40975DepositorInsertMouse GFAP promoter fragment
ExpressionMammalianAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only