We narrowed to 62,913 results for: cloning
-
Plasmid#29718DepositorTypeEmpty backboneTags6xHis, Strep Ii, and TEV cleavage siteExpressionBacterialPromoterT7Available sinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pME-Cas9-T2A-GFP
Plasmid#63155PurposeMiddle Entry clone for Gateway containing a zebrafish codon-optimized Cas9 flanked by 2 NLS and followed by inframe GFP. Cas9 and GFP are separated by the sequence of a T2A self-cleaving peptide.DepositorInsertCas9-T2A-GFP
UseCRISPR; Tol2 middle entry vector for gatewayAvailable sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET Biotin His6 mCitrine LIC cloning vector (H6-mCitrine)
Plasmid#29724DepositorTypeEmpty backboneTags6xHis, AviTag (biotin), TEV cleavage site, and mC…ExpressionBacterialAvailable sinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pME-Cas9
Plasmid#63154PurposeMiddle Entry clone for Gateway containing a zebrafish codon-optimized Cas9 flanked by 2 NLSDepositorInsertCas9
UseCRISPR; Tol2 middle entry vector for gatewayAvailable sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hCas9
Plasmid#41815PurposeExpresses human codon optimized Cas9 nuclease for genome engineeringDepositorInsertCas9
UseCRISPRExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-PE2
Plasmid#132775PurposePrime editing in mammalian cells. This plasmid is used by PE2, PE3, and PE3bDepositorInsertPE2
TagsSV40 NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SP-dCas9-VPR
Plasmid#63798PurposeSP-dCas9 with VP64-p65-Rta (VPR) fused to C-terminus; mammalian vectorDepositorInsertSP-dCas9-VPR
UseCRISPR and Synthetic BiologyTagsVPR (VP64-p65-Rta)ExpressionMammalianPromoterCMVAvailable sinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-SFFV-dCas9-BFP-KRAB
Plasmid#46911PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domainDepositorInsertdCas9-BFP-KRAB fusion
UseCRISPR and LentiviralTags2xNLS, BFP, HA, and KRAB domainExpressionMammalianPromoterSFFVAvailable sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMOD_B2112
Plasmid#91064PurposeModule B, Promoter: PvUbi1, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterPvUbi1Available sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP
Plasmid#64323PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-EBFP2ExpressionMammalianPromoterCBh and U6Available sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMOD_C3001
Plasmid#91094PurposeModule C, Promoter: 35S, Gene: GFP (+ BaeI site for GT donor cloning), Terminator: pea rbcsE9DepositorInsertGFP (+ BaeI site for GT donor cloning)
UseUnspecifiedPromoter35SAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-hTERT-IRES-hygro
Plasmid#85140PurposeLentiviral expression of hTERT, used to create immortalized cell linesDepositorAvailable sinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSCBE3-NG-HF1
Plasmid#218160PurposeThis plasmid harbors the base editor SCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-Hypa
Plasmid#218161PurposeThis plasmid harbors the base editor SCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1-Hypa
Plasmid#218158PurposeThis plasmid harbors the base editor SCBE3-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.eB
Plasmid#103005Purposenon-standard AAV2 rep-AAV-PHP.eB cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.eB VP1 gene
UseAAVExpressionMammalianPromoterp41Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BPK2660
Plasmid#70709PurposeHuman expression plasmid for SaCas9 sgRNA(84nt in length) (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sa-sgRNA(84)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXR001: EF1a-CasRx-2A-EGFP
Plasmid#109049PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-EGFP for RNA targetingDepositorInsertCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianPromoterEF1AAvailable sinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by