We narrowed to 5,993 results for: crispr cas9 expression plasmids
-
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only
-
AAV:ITR-EF1aCore-SaCas9-single(U6-sgRNA(backbone))-ITR
Plasmid#207880PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK1314-AAV-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223159PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6 and short human rhodopsin promoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBK1304-AAV-EFSNC-dCjCas9-KRAB-MECP2
Plasmid#223149PurposeExpression of KRAB and truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1297-AAV-EFSNC-dCjCas9-HP1b(79-173)
Plasmid#223142PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1307-AAV-EFSNC-dSaCas9-HP1b(79-173)
Plasmid#223152PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorInsertGFP, sgHTT and sgCas9 (HTT Human)
UseAAV and CRISPRTagsExpressionMutationPromoterEFS and U6Available sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianMutationPromoterAvailable sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.dTomato
Plasmid#89392PurposeLentiviral CRISPR-Cas9 delivery for sgRNA (hU6), dTomato coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTBL1401 pLenti-pEF1a(short)-mNeonGreen-P2A-Cas9
Plasmid#163644PurposeMakes a lentivirus that expresses mNeonGreen and Cas9.DepositorInsertmNeonGreen-P2A-Cas9
UseLentiviralTagsmNeonGreen-P2AExpressionMutationPromoterEFSAvailable sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA
Plasmid#61593PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTagsHA, NLS, and OLLAS tagExpressionMammalianMutationK175R and K736R (deUb mutations)PromoterAvailable sinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLII-CRISPR for CKA4
Plasmid#238521PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha4DepositorInsertAtCK2alpha4 (AT2G23070 Mustard Weed)
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning siteExpressionMutationPromoterEFS (P2A)Available sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR
Plasmid#100008PurposeExpresses Cas9-Nlux and sgRNA in Nannochloropsis oceanica, contains hygromycin resistance cassette, for integration into genomeDepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-NluxExpressionMutationPromoterRibi promoterAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP791_PB_dCas9-SSSavi_BirA
Plasmid#211786PurposePiggyBac plasmid with dCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), and BirA, with Hygro selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
UseTags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpCAGG abd pEF1aAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorInsertsgRNA (SOX17 Human)
UseCRISPRTagsHAExpressionMammalianMutationPromoterU6Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR-GFP
Plasmid#100009PurposeExpresses Cas9-GFP and sgRNA in Nannochloropsis oceanica, contains hygromycin resistance cassette, for integration into geneomeDepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-GFPExpressionMutationPromoterRibi promoterAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBK1303-AAV-EFSNC-dCjCas9-MECP2(204-310)
Plasmid#223148PurposeExpression of truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1298-AAV-EFSNC-dCjCas9-HP1bNH(111-173)
Plasmid#223143PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1313-AAV-EFSNC-dSaCas9-MECP2(204-310)
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianMutationPromoterAvailable sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.PAC
Plasmid#89393PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP321-pAAV-FullU6TO-SaCas9gRNAi(SapI)-CMV-TetR-P2A-GFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113698PurposeDox-inducible U6 SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IB801: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-KRAB
Plasmid#121823PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-CRISPR
Plasmid#85402PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expressionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCas9-VPR
Plasmid#68497Purposenuclease competent SP-Cas9 fused to VPRDepositorInsertSP-Cas9-VPR
UseTagsVPRExpressionMammalianMutationPromoterCMVAvailable sinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorInsertTERT sgRNA (TERT Human)
UseTagsExpressionMammalianMutationPromoteru6Available sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only