20,107 results
-
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pACYC-Skp-GroEL/ES
Plasmid#83922PurposeCo-expresses cytoplasmic copies of the Skp and Gro EL/ES protein folding chaperones.DepositorInsertsSkp
Gro EL/ES
ExpressionBacterialPromoterT7Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-TagGFP2-PuroR
Plasmid#80970PurposeCRISPaint gene taggingDepositorInsertTagGFP2
UseGene taggingPromoternoneAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-Zdk1
Plasmid#81057Purposemammalian expression of Zdk1DepositorInsertZdk1
Tags6x His tag, FLAG, and mCherryExpressionBacterial, Insect, and Mamm…Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIκBα-miRFP703
Plasmid#80005PurposeIκBα fused with near-infrared fluorescent protein miRFP703 (IκBα reporter)DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_erGAP3
Plasmid#78118PurposeLow affinity fluorescent calcium indicator of the GAP (GFP-Aequorin Protein) family targeted to the endoplasmic reticulumDepositorInserterGAP3
TagsKDEL and calreticulin signal peptideExpressionMammalianMutationS175G, D180Y, I167V and L15Q in GFP moiety and D…PromoterCMVAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_TRPM8
Plasmid#64879PurposeExpresses Ion Channel TRPM8 fused to eGFP in mammalian cellsDepositorInsertTransient receptor potential cation channel subfamily M member 8 (Trpm8 Rat)
TagseGFPAvailable SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
p323-L10A-PATagRFP
Plasmid#74172PurposeFluorescent reporter for single ribosome trackingDepositorAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.2.t1
Plasmid#73544PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.2.t1
pAcFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLS-mCherry-NES reporter (pDN160)
Plasmid#72660PurposeNLS-mCherry-NES 17 reporter for light-inducible nuclear export block with pDN157 and pDN158DepositorInsertNLS-mCherry-NES
ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-mEGFP-SpyTag
Plasmid#72325PurposeBacterial expression of monomeric enhanced green fluorescent protein (mEGFP) containing SnoopTag at the N-terminus and SpyTag at the C-terminus, for programmed polyprotein synthesis.DepositorInsertpET28a SnoopTag-mEGFP-SpyTag
TagsN-terminal His6 tagExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4-H6
Plasmid#71717PurposeMembrane scaffold protein (MSP), helix 4 to 6 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT040
Plasmid#67640PurposeURA3 vector for cloning guide sequences using BclI-SwaI sites into guide RNA expression cassetteDepositorInsertsingle guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT-EF-Pdgfrbeta-EGFPN
Plasmid#66790PurposeExpression of murine PDGFRbeta tagged with GFP under the control of EF1a promoterDepositorAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_neomycin
Plasmid#65306PurposeLuminal ER hook only (RUSH system)DepositorInsertStreptavidin fused to a signal sequence at 5' end and to a KDEL motif at 3' end
TagsKDEL motif and Signal SequenceExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-SP-Cas9 reporter
Plasmid#62733PurposeMammalian CRISPR-SP-Cas9 reporterDepositorInsertCRISPR-SP-Cas9 target seq + tdTomato (out of frame)
UseCRISPR and LentiviralTagsCRISPR-SP-Cas9 target seq (hAAVS1 locus) and HA t…ExpressionMammalianPromoterEF1-AlphaAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQE-80L MBP-SspB Nano
Plasmid#60409PurposeE. coli expression of SspB NanoDepositorInsertSspB nano
TagsHis-MBP-TEVExpressionBacterialMutationY11K and A15EAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
PGK-AAVS1ZFNL
Plasmid#60916Purposeencodes zinc finger nuclease specific to AAVS1 locus (left)DepositorInsertAAVS1-ZFNL
PromoterPGKAvailable SinceFeb. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA-eGFP-Reporter
Plasmid#60719PurposeExpresses guide RNA used to activate pGL3-Basic-8x-gRNA-eGFP reporter.DepositorInsertgRNA (5'-AAAGGTCGAGAAACTGCAAA-3')
UseCRISPRExpressionMammalianPromoterU6 and mouse U6Available SinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits only