We narrowed to 7,309 results for: aav
-
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn-Flex RG-cerulean
Plasmid#98221PurposeCre dependent Cerulean-E2A-SADB19 rabies glycoprotein expression, under hSyn promoter, for producing AAV virusDepositorInsertCerulean-E2A-RG
UseAAVTagsceruleanPromoterhuman SynapsinAvailable SinceAug. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-soCoChR-GFP
Plasmid#107710PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. CAG promoterDepositorInsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterCAGAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.iAChSnFR-Venus-NULL
Plasmid#137960PurposeExpresses FLEXed iAChSnFR (non-binding yellow version) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding yellow variant)
UseAAV and Cre/LoxExpressionMammalianMutationY140A binding site mutationPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEPT_Cdk2-T160A-siR
Plasmid#73975PurposeHDR template to generate Cdk2-T160A-siRDepositorUseAAVMutationT160 mutated to Ala and siRNA target site mutatedAvailable SinceMarch 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-TdTomato-RAB11
Plasmid#203732PurposeAAV vector plasmid expressing human RAB11 fused to TdTomato under the human synapsin (SYN) promoterDepositorInsertRAB11 (RAB11A Human)
UseAAVTagsTdTomatoExpressionMammalianPromoterHuman synapsin promoterAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-Vmn1r86
Plasmid#133415PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 86DepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP5g-P2A-Vmn1r58
Plasmid#133418PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 58DepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FDIO-LACTB-dAPEX2
Plasmid#117181PurposePlasmid name in publication: pAAV-FDIO-IMS-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labelingDepositorInsertLACTB-dAPEX2
UseAAV; Flp/frtExpressionMammalianMutationW41F and A134P on soybean APXPromoterEF1aAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGrin1
Plasmid#124865PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS2603_AAV-Nme2-ABE8e-i1-U6-Rosa26
Plasmid#201685PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 and U6 driven sgRNA targeting the mouse Rosa26 geneDepositorInsertNme2-ABE8e-i1
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Flex-mRuby3-2A
Plasmid#203846PurposeNeuron specific expression of a Cre-dependent mRuby3DepositorInsertmRuby3
UseAAVAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX(S306D)-2A-mCherry
Plasmid#118292PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for aspartic acidDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationSerine 306 changed to Aspartic AcidPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX(S306A)-2A-mCherry
Plasmid#118291PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for alanineDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationchanged Serine 306 to AlaninePromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-jYCaMP1
Plasmid#135422PurposeYellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfectionDepositorInsertjYCaMP1
UseAAVExpressionMammalianPromoterhSynAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-pAceR-Kv2.1PR
Plasmid#195531PurposeRed fluorescent, positive response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertpAceR-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationVARNAM 78E, 81D, 92N; SI linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN_mEGFP-CREB (S133A)
Plasmid#137010PurposeAAV backbone, mEGFP-CREB donor for G-CREB with S133A mutationDepositorInsertCREB1 (Creb1 Rat)
UseAAVTagsmEGFPExpressionMammalianMutationChanges Serine 133 into AlaninePromoterhSynapsinAvailable SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-soCoChR-mCardinal
Plasmid#107713PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. hSynapsin promoterDepositorInsertsoCoChR-mCardinal
UseAAVTagsKA2 and mCardinalExpressionMammalianPromoterhSynAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-PGD2-1.1
Plasmid#214764PurposeAAV packaging plasmid for GRAB PGD2-1.1 fluorescent sensor under EF1alpha promoterDepositorInsertGRAB-PGD2-1.1 sensor
UseAAVPromoterEF-1-alpha promoterAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL437 AAVS1 EQR sgRNA
Plasmid#126447PurposeTo cut the human AAVS1 locus for integration.DepositorInsertspacer against human AAVS1 safe-harbor locus with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro Xlone SOX17
Plasmid#179838PurposeDoxycycline-inducible expression of human SOX17DepositorInsertSOX17 (SOX17 Human)
UseAAV, CRISPR, Synthetic Biology, and TALEN ; Donor…ExpressionMammalianPromoterTRE3GSAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV Fos YFP MS2
Plasmid#131775PurposeFos upstream msfYFP 24xMS2 Fos downstream for CRISPR taggingDepositorInsertmsfYFP - 24x MS2 loops
UseAAV and CRISPRPromotern/aAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_UCN1.0
Plasmid#208668PurposeExpresses the genetically-encoded fluorescent urocortin (UCN) sensor GRAB_UCN1.0 in neuronsDepositorInsertGPCR activation based urocortin (UCN) sensor GRAB_UCN1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV CB6 FFLuc-miR122
Plasmid#35656DepositorAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 ChR2 ET-TC 2A tDimer
Plasmid#101361PurposeHigh efficiency channelrhodopsin, neuron specific promoter, red fluorescent proteinDepositorInsertsChannelrhodopsin-2
synaptophysin-red fluorescent protein
UseAAVExpressionMammalianMutationE123T , T159CPromoterhuman SynapsinAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-IRES-hrGFP
Plasmid#107549Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression IRES-hrGFPDepositorTypeEmpty backboneUseAAVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-miniSOG-VAMP2-citrine
Plasmid#50969PurposeAAV2 transfer vector containing the InSynC (miniSOG-VAMP2-citrine) constructDepositorInsertminiSOG-VAMP2-citrine (Vamp2 Mouse, Arabdopsis thaliana)
UseAAVTagscitrine and miniSOGPromoterhuman synapsin promoterAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN_mMaroon-KIX-mMaroon
Plasmid#137009PurposeAAV backbone, mMaroon-KIX acceptor for R-CREBDepositorAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.A184S
Plasmid#106183PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1InsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterhSynapsinAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-JEDI-1P-WPRE
Plasmid#202616PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-1P
UseAAVExpressionMammalianPromoterGFAPAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SYN-GFP-BGHpA
Plasmid#190229PurposeExpresses EGFP in neuronal cellsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-DreO-4x6T
Plasmid#196413PurposeAstrocytic expression of Dre recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorInsertDreO
UseAAV; Astrocyte-selectiveExpressionMammalianPromoterCAG and GfaABC1DAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iATPSnFR2.A95K.HaloTag
Plasmid#209660PurposeExpression of iATPSnFR2, medium affinityDepositorInsertiATPSnFR2.A95K.HaloTag
UseAAVMutationA95KPromoterGFAPAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP301-pAAV-CMV-MCS3-pA
Plasmid#113676PurposeCMV driven Multi Cloning Site-3DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mR2-CAAX
Plasmid#183871PurposeRepair template for the stable expression of a mRuby2-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mRuby2-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmRuby2-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mScarlet-I-Cdt1
Plasmid#191100PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmScarlet-I-Cdt1 (30-120)
UseAAV and Synthetic BiologyTagsmScarlet-I fused to residues 30-120 of human Cdt1…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6sgp53-mTSG-GFAPCre
Plasmid#100276PurposeAAV-CRISPR library for pool mutagenesis of top tumor suppressor genesDepositorUseAAV, CRISPR, Mouse Targeting, and Synthetic Biolo…ExpressionMammalianAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Neo-TNNT2-Puro
Plasmid#214016PurposeExpression of cardiac troponin TDepositorInsertTNNT2 (TNNT2 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Neo-TNNT2-Zeo
Plasmid#214017PurposeExpression of cardiac troponin TDepositorInsertTNNT2 (TNNT2 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-mRuby3-WPRE
Plasmid#135427PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterEf1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChromeQ-GFP
Plasmid#123317PurposeAAV-mediated expression of ChromeQ-GFP under the Syn promoter.DepositorInsertChromeQ-GFP
UseAAVTagsGFPExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterSynAvailable SinceMarch 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-K-red-SPOTIT
Plasmid#191490PurposeRed fluorescent-based opioid sensor for the kappa opioid receptor in AAV viral vector under a CAG promoterDepositorInsertK-red-SPOTIT
UseAAVPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-M-red-SPOTIT2
Plasmid#191491PurposeRed fluorescent-based opioid sensor for the mu opioid receptor in AAV viral vector under a CAG promoterDepositorInsertM-red-SPOTIT2
UseAAVPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_CCK1.0
Plasmid#208674PurposeExpresses the genetically-encoded fluorescent cholecystokinin (CCK) sensor GRAB_CCK1.0 in a cre-dependent mannerDepositorInsertGPCR activation based cholecystokinin (CCK) sensor GRAB_CCK1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAav-TP53-T2A-BirA*
Plasmid#115652PurposerAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassetteDepositorUseAAVTagsBirA* and T2AMutationHomology region 1 and Homology region 2Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-tdTomato
Plasmid#122099PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only