We narrowed to 2,568 results for: PGK
-
Plasmid#164077PurposeTargeted integration of SARS-CoV-2 spike HexaPro variant into the AAVS1 genomic safe harbor locusDepositorArticleInsertSARS-CoV-2 S HexaPro (S Severe acute respiratory syndrome coronavirus 2)
UseCRISPRTags2X Strep-Tag II, 8X His tag, and HRV 3C cleavage …ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCAGAvailable SinceJan. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUDE1093
Plasmid#204227PurposeEpisomal yeast plasmid expressing the Ercas12aDepositorInsertEubacterium rectale cas12a (Ercas12a)
ExpressionYeastMutationcodon optimized for S. cerevisiaePromoterSaccharomyces cerevisiae PGK1Available SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
OVA-miSFIT-2xPerfect
Plasmid#124673PurposeTuning expression of cytosolic Ovalbumin coupled to EGFPDepositorInsertCyto-Ovalbumin
ExpressionMammalianMutationTruncated OVA for cytoplasmic expressionPromoterminimal CMVAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
OVA-miSFIT-1xPerfect
Plasmid#124674PurposeTuning expression of cytosolic Ovalbumin coupled to EGFPDepositorInsertCyto-Ovalbumin
ExpressionMammalianMutationTruncated OVA for cytoplasmic expressionPromoterminimal CMVAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pILGFPEasy9R
Plasmid#218291PurposePlasmid-free in-situ promoter cloning and characterisation system in S. cerevisiae, allows the characterisation of a bidirectional promoter using yEGFP and E2-Crimson as reporters.DepositorInsertpURA3>KlURA3>tKlURA3-tPGK1KanMX>tAgTEF-pMAL32>MazF(RPL28i)-E2Crimson>tPDC1-pDDI2>ISceI>tSynth3>ura3(4,191)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX305-N-dTAG-CARD8-ZUC
Plasmid#169990PurposeMammalian expression of the dTAG-CARD8 ZUC (L162M-L537) fusion protein for controllable activation with dTAG ligands (dTAG13, dTAGV-1).DepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
dTAG NLRP1 P1214R
Plasmid#166826PurposedTAG (degron tag) NLRP1 for ligand-controlled N-terminal degradationDepositorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG
Plasmid#91797PurposeLentiviral/gateway cloning vector for N-terminally tagging proteins of interest with the dTAG systemDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsFKBP F36VExpressionMammalianPromoterhPGKAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-shRNA
Plasmid#82697PurposeFor targeting shRNA construct into human AAVS1 locus, using genome editing. Expresses shRNA of interest (cloning: EcoRI and AgeI) under U6 promoter, flanked by AAVS1 homology arms.DepositorTypeEmpty backboneUseRNAiPromoterhPGK, U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-Ce67
Plasmid#124680PurposeTuning expression of PD-1DepositorAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF.GFP
Plasmid#17616DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-4x
Plasmid#124678PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
LV-LIN28A
Plasmid#117057PurposeOverexpression of mouse LIN28ADepositorAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZ699
Plasmid#208117PurposePayload yeast assembly vector with TK-mActb on backboneDepositorTypeEmpty backboneUseSynthetic Biology; Copy number inducibleExpressionBacterial, Mammalian, and Y…PromoterHuman PGK1 for thymidine kinaseAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNW538_pAAVS1-pAP1(2)-FlpO-ABI-P2A-PYL-FlpO-CAG-U1-frt-STOP-frt-U2-GFP-P2A-luc2-ZeoR
Plasmid#192939PurposeFlpO-based digitizer circuit driven by AP1 promoterDepositorInsertsAP1(2)/minTK promoter
FlpO-ABI
PYL-FlpO
CAG promoter
frt-STOP-frt
GFP
luciferase
pPGK
Zeocin resistance
BFP
UseSynthetic BiologyExpressionMammalianAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2
Plasmid#85208PurposeBackbone for lentiviral gene silencing with monomeric Kusabira-Orange2 expressionDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-6-C, 16-C
Plasmid#124681PurposeTuning expression of PD-1DepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-L1-miSFIT-Ce67
Plasmid#124686PurposeTuning expression of PD-1DepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-1x
Plasmid#124679PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-12-C, 21-G
Plasmid#124683PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-L1-miSFIT-1x
Plasmid#124685PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2/CMV-eGFP.PB/PTK
Plasmid#170540PurposeExpresses the puromycin resistance gene fused to a thymidine kinase, upon excision of this cassette the reading frame of eGFP is restoredDepositorInsertDelta 5'-eGFP CMV-PuroTK- Delta 3'-eGFP
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PD-L1-miSFIT-4x
Plasmid#124684PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
PD-L1-miSFIT-6-C, 16-C
Plasmid#124689PurposeTuning expression of PD-1DepositorAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-1-A, 5-A
Plasmid#124682PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-L1-miSFIT-12-C
Plasmid#124687PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIALD2HMGr
Plasmid#185867PurposeKnocking out ALD6; expressing acetylating aldehyde dehydrogenase (Lactobacillus reuteri pduP and L. reuteri EutE) and an NADH-preferring HMG-CoA reductase (Delftia acidovorans mvaA) in S. cerevisiaeDepositorInsertALD6(-125, 40)> PSk.GAL1>Da.mvaA>TPGK1-PADH1> Lr.pduP> TPDC1-PGAL2>Lr.EutE-ALD6(1054, 1749)
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PD-L1-miSFIT-9-G, 15-C
Plasmid#124688PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAN1646
Plasmid#127205PurposepTet expression of Venus, Dual inducible expression of dCas9-VP64-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertp7x_tet-Venus-tADH1-pGal1-dCas9-VP64-Linker-mScarlet-Linker-degronSwitch_A_t12-tPGK1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tSSA1
UseSynthetic BiologyAvailabilityAcademic Institutions and Nonprofits only -
pRRLsin-SV40 T antigen-IRES-mCherry
Plasmid#58993Purposelentiviral expression of SV40 large T antigen and mCherry red fluorescent reporterDepositorInsertsCMV enhancer-chicken beta actin promoter
SV40 large T antigen
IRES-mCherry red fluorescent protein
UseLentiviralExpressionMammalianMutationEcoRV site in MCS converted to BamHI sitePromoterCMV enhancer-chicken beta actinAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cilantro 2
Plasmid#74450PurposeCan clone in a C2H2 zinc finger via BsmBI restriction sites and monitor post-translational degradation using EGFP:mCherry ratio (Lentiviral, PGK.BsmBICloneSite-EGFP.IRES.mCherry.cppt.EF1a.PuroR)DepositorTypeEmpty backboneUseLentiviralTagsEGFPAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch1#1/Cre
Plasmid#193223PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch1 geneDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#2/Cre
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#1/Cre
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#2/Cre
Plasmid#193236PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#1/Cre
Plasmid#193242PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#2/Cre
Plasmid#193243PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#1/Cre
Plasmid#193248PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#1/Cre
Plasmid#193239PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#1/Cre
Plasmid#193229PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#2/Cre
Plasmid#193240PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSphkap#2/Cre
Plasmid#193241PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sphkap geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#2/Cre
Plasmid#193238PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#1/Cre
Plasmid#193237PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#2/Cre
Plasmid#193247PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only