We narrowed to 2,515 results for: gcg
-
Plasmid#90617Purpose3rd generation lentiviral gRNA plasmid targeting human CENPFDepositorInsertCENPF (Guide Designation C6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
shCTL-mlpx-neo
Plasmid#65233Purposeencodes a non-targeting control shRNADepositorInsertnon-coding shRNA
ExpressionMammalianPromoterPGKAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP54-5
Plasmid#65599Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP54-3
Plasmid#65597Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_6
Plasmid#163460Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin1
Plasmid#124852PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-GFP KI
Plasmid#131497PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL005-SOX2-sgRNA
Plasmid#175553PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.DepositorInsertspCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
px458_2A_GFP_sgRNA_LTN1
Plasmid#127125DepositorInsertgRNA LTN1 (LTN1 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
SPHK1 gRNA (BRDN0001147454)
Plasmid#76813Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgIRF3#5
Plasmid#127642PurposeKnock-out of human IRF3DepositorInsertIRF3 sgRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-shNC-mCherry
Plasmid#222962PurposeNegative control for lentiviral shRNADepositorInsertNegative control
UseLentiviralAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro_shDDX58_230212
Plasmid#167293PurposeLentiviral plKO.1 construct coding for a short-hairpin RNA targeting the human gene DDX58 (coding for RLR sensor RIG-I). Contains a puro resistance cassette.DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
SOX17-3'gRNA
Plasmid#210465PurposegRNA targeting SOX17 3' terminal for CRISPR-Cas9-mediated knock-inDepositorInsertSOX17 (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-VIM
Plasmid#227301PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of VIM for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102798PurposeRetrovirus for delivery of one sgRNA (self-targeting) - GFP-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE)
Plasmid#214878PurposeLentiviral vector encoding RfxCas13d targeting SURF1 guide arrayDepositorInserthU6-crSURF1-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPELO #2
Plasmid#229020PurposeExpression of a CRISPRi doxycycline inducible guide targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001149054)
Plasmid#76712Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg2
Plasmid#124857PurposeMutagenesis of Gabrg2DepositorInsertGabrg2 (Gabrg2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA14
Plasmid#199586PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_Luciferase_sgRNA
Plasmid#74190Purposelentiviral vector expressing sgRNA targeting LuciferaseDepositorInsertLuciferase sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only