We narrowed to 79,968 results for: Rest
-
Plasmid#98358PurposeLentiviral expression of POLD1DepositorAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
RBM14_pLX307
Plasmid#98367PurposeLentiviral expression of RBM14DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
PCBP1_pLX307
Plasmid#98362PurposeLentiviral expression of PCBP1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pDONR223_HyPer7RgDAAO
Plasmid#217746PurposeDonor vector for gateway cloning of HyPer7 DAAO, a fusion protein used to measure the uptake of D-amino acids across the plasma membrane.DepositorInsertHyPer7 D amino acid oxidase
TagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-CMV-puro-2A-BLM
Plasmid#127641PurposeOver-expression of human BLMDepositorInsertBLM (BLM Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68717PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVMutationCre-dependent expression from inverted open readi…PromoterCAG-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-HP1α-miRFP670-Cry2WT
Plasmid#122442PurposeExpresses disordered protein HP1α fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertHP1 alpha (CBX5 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianPromoterSFFVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC9-C169S
Plasmid#231673PurposeExpresses human ZDHHC9-C169S proteinDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFRLuc-CoV2-FLucStop
Plasmid#177617PurposeDual luciferase reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. In-frame stop codon inserted after FLuc (negative control).DepositorInsertSARS-CoV-2 FSE
UseLuciferaseExpressionMammalianMutationIn-frame stop codon added between FLuc and FSEAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GABRA1(A322D)-IRES2-EGFP
Plasmid#170821Purposehuman GABAA receptors alpha1 subunit carrying A322D mutation and IRES2-EGFPDepositorInsertHuman GABAA receptor alpha1 subunit carrying A322D mutation (GABRA1 Human)
TagsIRES2-EGFPExpressionMammalianMutationchange Alanine 322 to AspartateAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68720PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVMutationCre-dependent expression from inverted open readi…PromoterhSyn1-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE-FH-TET3 short
Plasmid#166916PurposeLentivirus for inducible overexpression of human TET3 short isoform lacking CXXC domain (NM_001366022.1)DepositorInsertTET3 short isoform
UseLentiviralTagsHA TagExpressionMammalianMutationChanged nucleotide 18 (G) to (A) to delete FseI r…Available SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
EMR2_pLX307
Plasmid#98332PurposeLentiviral expression of EMR2DepositorAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
UQCRB_pLX307
Plasmid#98381PurposeLentiviral expression of UQCRBDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_SOX2
Plasmid#45270DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-T2A-mCherry-PTS1
Plasmid#87827PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using T2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRAPPC8_pLX307
Plasmid#98375PurposeLentiviral expression of TRAPPC8DepositorAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-mR2
Plasmid#183866PurposeRepair template for the C-terminal tagging of H2B histones with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mRuby2 (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mRuby2ExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-MYH10
Plasmid#183869PurposeRepair template for the N-terminal tagging of myosin heavy chain 10 with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertMYH10 homology arms with mRuby2-linker (MYH10 Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_FNDC3B
Plasmid#45269DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
(194) pcDNA3.1-HA-nEPEA-(EAAAK)4-OGT(4,K852A)
Plasmid#160742PurposeExpresses an inactive truncated OGT (4.5 TPRs, K852A) that can't bind O-GlcNAc fused to the EPEA nanobody. A different nanobody can be inserted by using Sgfl + Sgsl restriction enzymes.DepositorInsertHA-nEPEA-(EAAAK)4-OGT(4,K852A)
TagsHA-TagExpressionMammalianPromoterT7/CMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_EIF5A2
Plasmid#45266DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP MPS1 K-R
Plasmid#59819PurposeAllows the integration of GFP MPS1 K-R in the genome and Tet-inducible expression.DepositorInsertMps1 (TTK Human)
TagsEmGFPExpressionMammalianMutationKD, catalytically inactive, D664APromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_GPR160
Plasmid#45274DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAS-sgATG7
Plasmid#75228PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor GammohDepositorAvailable SinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWzl_neo_DEST_flag_SOX2
Plasmid#45309DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSP1-mp53AS-6xMUT
Plasmid#20904DepositorInsertp53AS (Trp53 Mouse)
ExpressionMammalianMutationpoint mutation (Ser/Thr-Ala) of the 6 N-terminal …Available SinceApril 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
MTS-FUS(IDR)-mCh-CRY2olig
Plasmid#254612PurposeExpresses mt-optoIDR with FUS (1-214 aa) to optogenetically induce biomolecular condensates within mitochondrial matrix in living cells.DepositorAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTS-TWINKLE(IDR)-mCh-CRY2olig
Plasmid#254613PurposeExpresses mt-optoIDR with TWINKLE (1-170 aa) to optogenetically induce biomolecular condensates within mitochondrial matrix in living cells.DepositorAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDD3248 pCS2-mtagBFP2-p2a-NES-arrb2a-(ENLYFQ/S)x3-SV40NLS-sfCherry3C(1-10)
Plasmid#251770PurposeBlue fluorescent protein-tagged TEVp substrate (three-peat motif) for fluorescent protein reconstitution assayDepositorInsertarrestin, beta 2a (arrb2a Zebrafish)
TagsNLS (SV40), sfCherry3C large fragment and mTagBFP…ExpressionMammalianPromoterCMV IE94Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-GFP-MeCP2 (pc4741 )
Plasmid#249083PurposeBacteria expression plasmid of GFP-MeCP2DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
hTRAK1(S200A, S201A, S719A, S919A)
Plasmid#225225PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A, S719A, S919A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationS200A, S201A, S719A, S919A mutationsPromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
MYC-hTRAK1(S200A, S201A)
Plasmid#219572PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationSerine 200 changed to alanine, serine 201 changed…PromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-EGFR- FCRL3-50aa-Chimera-puro
Plasmid#248150PurposeLentiviral vector encoding a chimeric protein composed of the transmembrane region of FCRL3 and its truncated cytoplasmic tail (aa 595-644; first 50 residues), fused to the extracellular domain of EGFR.DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-EGFR-FCRL3-93aa-Chimera-puro
Plasmid#248149PurposeLentiviral vector encoding a chimeric protein composed of the transmembrane region of FCRL3 and its truncated cytoplasmic tail (aa 595-687; first 93 residues), fused to the extracellular domain of EGFR.DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
RC00214-pcsb-35Sp-ccdB-mNG-OCSp-tdT
Plasmid#209019PurposeDual-fluorescence acceptor plasmid for one-step insertion of a 5' leader of interest between the CaMV35S promoter and mNeonGreen via BpiI. A tdTomato expression cassette serves as internal control.DepositorInsertsccdB
mNeonGreen
tdTomato
ExpressionPlantMutationcodon optimized for N. benthamianaPromoterCaMV35S and Octopine SynthaseAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-3UTR
Plasmid#202550PurposeReady for cloning and heterologous expression of genes in mammalian cells with protein export to cultivation mediaDepositorTypeEmpty backboneTagsATG initiation codon followed by an IGKV3 signal …ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#1/Cre
Plasmid#193244PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-TagBFP
Plasmid#183867PurposeRepair template for the C-terminal tagging of H2B histones with mTagBFP in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mTagBFP (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mTagBFPExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST*-GFP
Plasmid#163667PurposeExpresses partial length ST in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (first 113 amino acids) (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationThis chimera contains the first 113 amino acids o…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/ TO myc-cCE-bio (cCE-bio)
Plasmid#82473PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal biotin tagged mRNA capping enzyme, inactive formDepositorInsertMyc-NES-mCE (Wt, NLS deletion)-TEV-Bio (Rngtt Synthetic, Mouse)
TagsTEV-Biotin and mycExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475)
Plasmid#50875PurposeExpresses human NKCC1 I674C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI674C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only