We narrowed to 13,947 results for: CRISPR-Cas9
-
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-DDdCas9VP192-T2A-EGFP-ires-puro
Plasmid#69534PurposeDHFR destabilised domain (DD) fused to dCas9VP192 (S.pyogenes) on CAG expression vector. DDdCas9VP192 protein is stabilised by Trimethoprim.DepositorInsertDD-dCas9VP192-T2A-EGFP
TagsC-term T2A-EGFP and DHFR Destabilised DomainExpressionMammalianPromoterCAGAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL
Plasmid#79614PurposeExpresses dCas9-SH3 and PmCDA1-SHL in yeast cellsDepositorInsertsSpCas9
PmCDA1
TagsSH3 domain and SHLExpressionYeastMutationD10A and H840A for nuclease deficient Cas9PromoterpGal1 and pGal10Available SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG>nls-Cas9-nls-2A-Citrine-EcoRI/NotI
Plasmid#169097PurposeCas9 and Citrine expression in transfected cellsDepositorInsertCas9-2A-Citrine
ExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
EFS-FLAG-SpCas9-6xNLS(c-Myc)-P2A-Puro (pRG214)
Plasmid#221385PurposeLentiviral expression of SpCas9-6xNLS(c-Myc) with puromycin resistance geneDepositorInsertSpCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianAvailable SinceJune 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRha-ABE8e-SpCas9-NG
Plasmid#201190PurposeExpresses the base editor ABE8e-SpCas9-NG in bacterial cellsDepositorInsertABE8e-SpCas9-NG
Tags8xHIS and BP-NLSExpressionBacterialPromoterpRhaBADAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori
Plasmid#234737PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.DepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iC
Plasmid#231418PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-C1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ290.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iA
Plasmid#231417PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-A1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ285.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa2-Cas9-GFP
Plasmid#208050PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa2DepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-Blast
Plasmid#87155Purposelentiviral expression of SpCas9-VQR (NGA PAM restricted)DepositorInsertSpCas9-VQR(D1135V,R1335Q,T1337R)
UseLentiviralMutationD1135V,R1335Q,T1337RAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE2_pLVX-EF1a-dCas9-CBio-IRES-zsGreen1
Plasmid#138418PurposeCAPTURE2.0 vector containing dCas9-CBio, IRES and zsGreen1DepositorInsertdCas9
UseLentiviralTagsBioTAP-tagPromoterEF1aAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE2_pLVX-EF1a-NBio-dCas9-IRES-zsGreen1
Plasmid#138419PurposeCAPTURE2.0 vector containing NBio-dCas9, IRES and zsGreen1DepositorInsertdCas9
UseLentiviralTagsBioTAP-tagPromoterEF1aAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorInsertnCas9h840a-xten-R2Tocc
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
Plasmid#234883Purposenon-targeting CRISPRi controlDepositorInsertL1HS gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-Slug-nCas9(D10A)-PolI5MΔ
Plasmid#249078PurposeExpresses nucleus-localized Slug-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertSlug-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
U6-Slc1a3 sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194283PurposeEF1a-dCas9-KRAB-GFP with Slc1a3 sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-Sniper-nCas9(D10A)-PolI5MΔ
Plasmid#249071PurposeExpresses nucleus-localized Sniper-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertSniper-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-SuperFi-nCas9(D10A)-PolI5MΔ
Plasmid#249070PurposeExpresses nucleus-localized SuperFi-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertSuperFi-nCas9-PolI5M?
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-HSC1.2-nCas9(D10A)-PolI5MΔ
Plasmid#249073PurposeExpresses nucleus-localized HSC1.2-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertHSC1.2-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-LZ3-nCas9(D10A)-PolI5MΔ
Plasmid#249072PurposeExpresses nucleus-localized LZ3-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertLZ3-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-HF1-nCas9(D10A)-PolI5MΔ
Plasmid#249075PurposeExpresses nucleus-localized HF1-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertHF1-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-Hypa-nCas9(D10A)-PolI5MΔ
Plasmid#249076PurposeExpresses nucleus-localized Hypa-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertHypa-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-SpRY-nCas9(D10A)-PolI5MΔ
Plasmid#249074PurposeExpresses nucleus-localized SpRY-nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertSpRY-nCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
IF405: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-p300core
Plasmid#121825PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IA304: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-VPR
Plasmid#121822PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/VPR (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-pSFFV-dCas9-SunTag-P2A-BFP-dWPRE
Plasmid#122151PurposeExpresses dCas9-SunTag(24X) fusion and a fluorescent indicator BFP.DepositorInsertdCas9 fused to SunTag(24x)
UseLentiviralTags2xNLS-P2A-BFP and NLSExpressionMammalianPromoterSFFVAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMEH305 HA NLS SpCas9 3x high affinity MS2 loops
Plasmid#168216PurposeMammalian expression SV40 and nucleoplasmin NLS SpCas9 with 3 high affinity MS2 loops and fused to an N-terminal HA tagDepositorInsertSV40 NLS SpCas9
UseLentiviralTagsHA, SV40 NLS, and nucleoplasmin NLSExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-Zif268
Plasmid#69224PurposeExpresses R1335K mutant SpCas9 fused to Zif268 in mammalian cellDepositorInsertSpCas9
UseCRISPRTagsNLS-3XHA-NLS and Zif268ExpressionMammalianMutationArginine 1335 is changed to LysineAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS2
Plasmid#69228PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS2 in mammalian cellDepositorInsertTS2 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only