We narrowed to 8,876 results for: sgrna
-
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantPromoterU6 promoterAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA-MsgRNA-EGFP
Plasmid#80794PurposeFor insertion of gRNA array containing 11-30 gRNA modulesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ACTB_sgRNA
Plasmid#183885PurposepX459V2.0-HypaCas9 plasmid with ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA1
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CBE-sgRNA
Plasmid#221137PurposeHelper plasmid for sgRNA cloning for CRISPR-Cas9 cytosine base editing. sgRNA-scaffold with Cas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with Cas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #2
Plasmid#61514Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgccgctcccggatctcctgc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ANLN_sgRNA
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA2
Plasmid#134636Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA2 (UFL1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCJH009_proD_Cas12c-sgRNA-GFP_CAM
Plasmid#183070PurposePlasmid expressing Cas12c sgRNA targeting GFP (1) for in vivo interference assay in bacteria.DepositorInsertCas12c single guide RNA targeting GFP
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-a
Plasmid#87201PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting exon 1 of HTTDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA1
Plasmid#134635Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA1 (UFL1 Human)
ExpressionMammalianAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_GAL4UAS-Luciferase reporter
Plasmid#64159PurposePhotoactivatable transcription system. Lentiviral expression of sgRNA3 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA3 for GAL4UAS-Luciferase reporter
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-b
Plasmid#87200PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting 5' UTR of HTTDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#1
Plasmid#189987PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
psgRNA2.02-PP7-ccdB
Plasmid#99912PurposeBasic cloning vector for the expression of PP7 inserted sgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
psgRNA2.02-MS2-ccdB
Plasmid#99911PurposeBasic cloning vector for the expression of MS2 inserted sgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-com-Ds
Plasmid#119077PurposeTo clone sgRNA spacer sequence for microinjections. This sgRNA tracrRNA contains 2x com stem loopsDepositorInsertU6a:2xCom-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-MS2-Ds
Plasmid#119076PurposeTo clone sgRNA spacer sequence for microinjections. This sgRNA tracrRNA contains 2x MS2 stem loopsDepositorInsertU6a:2xMS2-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA GAPDH
Plasmid#162736PurposeMammalian expressionDepositorInsertSpacer sequence for GAPDH
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 2
Plasmid#70657PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gfap-sgRNA
Plasmid#65566Purposein vitro trancription of sgRNA targeting the zebrafish gfap locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQCi-hTRAC-sgRNA
Plasmid#154093PurposepQCi backbone with sgRNA targeting human TCR-alpha common chainDepositorInsertsgRNA targeting human TRAC locus
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-SLC35B2-sgRNA
Plasmid#154860PurposeLentiviral expression of Cas9 and sgRNA targeting SLC35B2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_KCNA1-mcherry
Plasmid#159788PurposeS. pyogenes sgRNA collocated with pegRNA targeting human KCNA1 geneDepositorInsertspacer of sgRNA targeting KCNA1 gene (KCNA1 Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_SRD5A3-mcherry
Plasmid#159782PurposeS. pyogenes sgRNA collocated with pegRNA targeting human SRD5A3 geneDepositorInsertspacer of sgRNA targeting SRD5A3 gene (SRD5A3 Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 C64Y
Plasmid#139326PurposePlasmid expressing a sgRNA to introduce BRCA1 C64Y using base editingDepositorInsertsgRNA to insert BRCA1 C64Y using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only