173,178 results
-
Viral Prep#105548-AAV8PurposeReady-to-use AAV8 particles produced from pENN.AAV.CMVs.TurboRFP.WPRE.RBG (#105548). In addition to the viral particles, you will also receive purified pENN.AAV.CMVs.TurboRFP.WPRE.RBG plasmid DNA. CMV-driven TurboRFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVTagsTurboRFPAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pT7-V5-SBP-C1-HshnRNPQ_AA
Plasmid#148251PurposeMammalian Expression of HshnRNPQDepositorInsertHshnRNPQ (SYNCRIP Human)
ExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG413GAL-ccdB
Plasmid#14141DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseGateway destinationExpressionYeastAvailable SinceMarch 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
-
pTS2307-Tier1-2xcHS4-PPGK-NLuc_TB
Plasmid#169550PurposeTier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a tandem repeat of a 5' cHS4 insulator sequence (2xcHS4-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertcHS4-modulated PPGK-driven NanoLuc Luciferase - mTagBFP expression cassette
ExpressionMammalianPromoterPPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PPP2R2B
Plasmid#16181DepositorInsertPP2A regulatory subunit B, beta isoform (PPP2R2B Human)
ExpressionMammalianAvailable SinceJan. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pHSB04X
Plasmid#117258PurposeGenome editing for Lactobacillus brevis ATCC367DepositorInsertCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019
UseOtherAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-ABE N-terminal
Plasmid#137177PurposeAAV genome: expresses the N-terminal of v5 AAV-ABE from the Cbh promoterDepositorInsertv5 AAV-ABE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-APEX2-nDEST
Plasmid#214992PurposeGateway compatible empty vector (lentiviral/mammalian expression) with an N-terminal APEX2 tagDepositorTypeEmpty backboneUseLentiviralTagsFlag-APEX2ExpressionMammalianAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
EcNR1 Strain
Bacterial Strain#26930DepositorBacterial ResistanceAmpicillinAvailable SinceJan. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
At2S3:RUBY
Plasmid#160906PurposeRUBY under the control of At2S3 promoter/marker for Arabidopsis transgenesDepositorInsertRUBY and At2S3 promoter
ExpressionPlantPromoterAt2S3Available SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
p415 TEF Su9‐roGFP2‐Tsa2ΔCR
Plasmid#83240PurposeThe genetically encoded fluorescent H2O2 sensor roGFP2-Tsa2ΔCR cloned in the yeast p415 vector under the control of a TEF promoter. For mitochondrial matrix expression.DepositorInsertSu9-roGFP2-Tsa2dCr
TagsroGFP2 fusion with Tsa2dCr with Su9 targetting se…ExpressionYeastPromoterTEFAvailable SinceNov. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
beta Synuclein-VC
Plasmid#89484Purposeexpresses human beta Synuclein fused to the C-terminal part of VenusDepositorAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-dSaCas9-NLS-VPR
Plasmid#68495PurposeAAV vector containing nuclease null SaCas9 fused to VPRDepositorInsertdSaCas9
UseAAVTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRKH3-ermGFP
Plasmid#27169DepositorInserterythromycin ribosomal methylase promoter region fused with modified green fluorescent protein 5
ExpressionBacterialMutationpresence of an additional 183-bp region at N term…Available SinceFeb. 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
TFORF2594
Plasmid#144048PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-OSBP-PH
Plasmid#49571Purposeexpresses the plekstrin homology domain of OSBP in mammalian cellsDepositorAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8e-eVRQR-P2A-EGFP (HES1425)
Plasmid#242657PurposeCMV promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8e-SpCas9-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA, eVRQR mutations in SpCas…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH029
Plasmid#171060PurposePlasmid for expressing Gag fused to spyCas9-3x FLAG-2x SV40 NLS with the SQNYPIVQ HIV-1 cleavage site in betweenDepositorInsertGag-spyCas9
UseCRISPR and LentiviralTags2x SV40 NLS and 3x FLAG tagExpressionMammalianPromoterCAGAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRIS-PITChv2-FBL
Plasmid#63672PurposePITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locusDepositorInsertEGFP-2A-PuroR
UseCRISPRPromoterPromoterlessAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-CAG_3C-Twin-Strep
Plasmid#113901PurposeMammalian protein expressionDepositorTypeEmpty backboneUseLentiviralTags3C-Twin-StrepPromoterCAGAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
GPI-mEGFP
Plasmid#182866PurposeMonomer expression vector with plasma membrane localization signalDepositorInsertGPI-mEGFP
ExpressionMammalianAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Jacquere (all-in-one vector)
Pooled Library#247027PurposeHuman genome-wide CRISPR knockout library for the use of S. pyogenes Cas9. Each gene is targeted by 3 constructs.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-Frame +1
Plasmid#66940PurposeCRISPaint frame selector +1DepositorInsertgRNA frame +1
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCF525-EF1a-Hygro-P2A-mTagBFP2-lenti
Plasmid#115797PurposeExpresses mTagBFP in human cells, contained in a lentiviral vector.DepositorInsertmTagBFP
UseLentiviralExpressionBacterial and MammalianPromoterEF-1a promoterAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP14033: pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) (AAV PHP.eB)
Viral Prep#214852-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP14033: pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) (#214852). In addition to the viral particles, you will also receive purified AiP14033: pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) plasmid DNA. minBG-driven expression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs). These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsEGFPAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GRET
Plasmid#158222PurposeControl lentiviral plasmid encoding GFP-Nluc BRET reporter from Schaub et al., Cancer Research, 2015.DepositorInsertGFP-Nluc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only