We narrowed to 12,137 results for: NSI
-
Plasmid#226100PurposeHRI N-terminal region (residues 1-138) stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pRRL-VcnTS-E1015A-E1021A
Plasmid#213411PurposeVinculin tension sensor (VcnTS) with both directionally asymmetric, force strengthening (DAFS) variant point mutations (E1015A and E1021A), in lentiviral expression vector.DepositorInsertVcnTS-E1015A-E1021A (VCL Chicken, Synthetic)
UseLentiviralMutationMutated vinculin glutamic acid 1015 and 1021 to a…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Parkin(C431N)-A92mKO2
Plasmid#213545PurposeTransient mammalian expresssion of ligase-dead C431N Parkin, internally tagged with mKO2DepositorAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1TMSNKRS
Plasmid#198323PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(K363TAG)
Plasmid#182661PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K363 & an N-terminal FLAG tag (DYKDDDDK) in mammalian cells. Can be used for genetic code expansion & click labeling of NFL.DepositorInsertmouse neurofilament light chain with a K363TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK363TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1cdN243-C1
Plasmid#131838PurposeExpresses the last 50 amino acids of HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is a deletion contruct of the cytoplasmic m…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPMMLF1nes-C1
Plasmid#131849PurposeExpresses the N-terminal nuclear export signal of HcRed-NPMMLF1 in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is a control deletion contruct of the cytop…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGB_3alpha2 OplacI:mini35S:RDF:Tnos (GB1534)
Plasmid#160617PurposeTU for the regulated expression of the PhiC31 phage recombination directionality factor (RDF) gene driven by a synthetic promoter consisting of the LacI operator fused to the minimal 35S promoter.DepositorInsertRDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha2 OplexA:mini35S:PhiC31int:Tnos (GB1529)
Plasmid#160614PurposeTU for the regulated expression of the PhiC31 phage integrase gene driven by a synthetic promoter consisting of the LexA operator fused to the minimal 35S promoter.DepositorInsertPhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB_3alpha1 OplacI:mini35S:phiC31:Tnos (GB1530)
Plasmid#160615PurposeTU for the regulated expression of the PhiC31 phage integrase gene driven by a synthetic promoter consisting of the LacI operator fused to the minimal 35S promoter.DepositorInsertPhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromotermini35sAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1680_Sororin-Cterm
Plasmid#156451PurposeFor transient expression of Cas9 and sgRNA targeting mouse Cdc5a (SORORIN) stop codonDepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A LaG17-SynNotch 204TAA 442TAG
Plasmid#154778Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and LaG17-SynNotch 204TAA 277TAG, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertLaG17-SynNotch
TagsLaG17ExpressionMammalianMutation204TAA 442TAG in LaG17-SynNotch, hybrid PylT with…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-3
Plasmid#112843Purposetransient/stable overexpression of the C-terminal domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-1
Plasmid#112841Purposetransient/stable overexpression of the N-terminal domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorAvailable SinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1396
Plasmid#29194PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1617
Plasmid#29279PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle146 (NTSR1 Human)
UsePleiades promoter project [sic, pleaides plieades…TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOUPc-Rh159-GFP
Plasmid#179280PurposeAll in one "tet-on" lentivirus vector that expresses rhesus cytomegalovirus Rh159 fused to an eGFP tag at its cytoplasmic tail. Rh159 is an ER resident protein that binds NKG2D activating ligands.DepositorInsertRh159 fused to eGFP
UseLentiviral; All-in-one "tet" on lentivi…TagseGFPExpressionMammalianPromoterTet Responsive Element 3GAvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-HA
Plasmid#179344PurposeAll-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tailDepositorInsertRh159
UseLentiviral; All in one tet-on lentiviral vector (…TagsHA tagExpressionMammalianPromotertet responsive element 3GAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)
Plasmid#182287PurposeEncodes codon-optimized AF mutant of M. mazei-derived pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & tRNACUAPyl used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE-8XGTIIC-DsRED-DD
Plasmid#115798Purposelentiviral, trimethoprim (TMP) regulated YAP promoter activity reporterDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2(WT)-Fc(IgG1)
Plasmid#145163PurposeMammalian expression plasmid for soluble ACE2-Fc fusion (IgG1)DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFc region of human IgG1ExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Full length Importin beta
Plasmid#106941PurposeTransient expression of GFP-tagged Importin beta in mammalian cells (CMV promoter)DepositorInserthuman Importin beta-1 (KPNB1) (KPNB1 Human)
TagsGFPExpressionMammalianPromoterCMV promoterAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-PE2-P2A-BFP
Plasmid#231580PurposeExpresses the PE2 prime-editing machinery fused to BFP (PE2-P2A-BFP), under the control of a TRE3G promoter. This promoter is responsive to doxycycline bound to the rtTA proteinDepositorInsertPE2-P2A-BFP
UseLentiviralTagsP2A-BFPExpressionMammalianPromoterTRE3GAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup
Plasmid#90020PurposeTo express GFP-tagged Dsup in mammalian cells transientlyDepositorInsertDsup
TagsAcGFP1ExpressionMammalianPromoterCMVAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup-C
Plasmid#90022PurposeTo express GFP-tagged C-terminal region of Dsup in mammalian cells transientlyDepositorInsertDsup
TagsAcGFP1ExpressionMammalianMutationC-terminal region alonePromoterCMVAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Proinsulin-NanoLuc in pLX304
Plasmid#62057PurposeLuminescent reporter of insulin secretionDepositorInsertProinsulin-NanoLuc (Ins2 Mouse, Synthetic)
UseLentiviral and LuciferaseExpressionMammalianMutationInserted NanoLuc into C-peptide of mouse Ins2 cod…PromoterCMVAvailable SinceJan. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1
Plasmid#52326Purposeexpresses human syndecan 1 in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationR117Q mutation (R95Q according to numbering in Fi…PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7f
Plasmid#104483PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7f
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINE GFP nanobody:Halo:His6
Plasmid#111090PurposeBacterial expression of a fusion protein consisting of a GFP nanobody (Dr. Brett Collins, Addgene plasmid # 49172), the Halo tag and a His6 tag.DepositorInsertGFP Nanobody
TagsHalo and His6ExpressionBacterial, Insect, and Mamm…PromoterT7 promoterAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAcBac2.tR4-OMeYRS/GFP*
Plasmid#50831Purposebaculovirus-based delivery system that enables the efficient incorporation of unnatural amino acids into proteins in mammalian cellsDepositorInsertstwo-copy Tyr tRNA cassette
EGFP*
OMeYRS
two copy Tyr tRNA cassette
UseBaculoviralTagsHis, Myc-6xHis, and WPREExpressionInsectMutationY39TAG and able to charge various unnatural amino…PromoterCAG, CMV, and U6 and H1Available SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-ACE2
Plasmid#141185PurposeMammalian expression plasmid for human ACE2 with an N-terminal (extracellular) c-myc tagDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV GFAP jGCaMP7b
Plasmid#171118PurposeAstrocyte AAV-mediated expression of bright ultrasensitive protein calcium sensor under the GFAP promoterDepositorInsertjGCaMP7b
UseAAVTags6 His Tag, T7 Tag, and Xpress TagExpressionMammalianPromoterGFAPAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
L4857 dsRedExpress2 reporter, VEGFR2 NTEVp, VEGFR1 CTEVp in PiggyBac Transposon Vector
Plasmid#244187PurposePiggyBac transposon vector for expression of dsRed-Express2 synTF promoter; constitutive expression of VEGFR2 NTEVp chain, VEGFR1 CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRed-Express2 under synTF responsive promoter; VEGFR2 NTEVp chain with WT NTEVp; VEGFR1 CTEVp chain; mNeonGreen-P2A-PuroR
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-MTS-cox8A-GFP-IRES-mCherry
Plasmid#226103PurposeStability reporter construct of the COX8A mitochondrial targeting sequence (MTS) for transient expression in mammalian cellsDepositorInsertCOX8A (COX8A Human)
TagsGFPExpressionMammalianMutationencodes only for mitochondrial targeting sequence…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMega-MaPylRS
Plasmid#200225PurposeThe plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with Nε-Boc-lysine.DepositorInsertsPyrrolysyl-tRNA synthetase
pyrrolysyl-tRNA
TagsnoneExpressionBacterialMutationnonePromoterproK-lacO and tacIAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-NoMi-P2A-CopGFP-T2A-PuroR
Plasmid#207805PurposeE-NoMi is a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins under an EF-1α promoter.DepositorInsertE-NoMi
UseLentiviralTags3xFlag tag, copGFP, mCherry, and nanoluciferaseExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only