173,176 results
-
Plasmid#11941DepositorInsertUb-G76V-GFP
ExpressionMammalianMutationUbiquitin fused to N-terminus of GFP. Glycine 76 …Available SinceJune 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
mTagBFP2-Lysosomes-20
Plasmid#55308PurposeLocalization: Lysosome Membrane, Excitation: 399, Emission: 456DepositorInsertLAMP1
TagsmTagBFP2ExpressionMammalianPromoterCMVAvailable SinceOct. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-3XHA-TMEM192
Plasmid#104434PurposeExpresses 3XHA-TMEM192 in mammalian cellsDepositorAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pet30b-7M SrtA
Plasmid#51141Purposeexpression plasmid for C-terminal his tagged, calcium independent S.aureus SrtA with enhanced catalytic activityDepositorInsertS.aureus SrtA 7M
Tags6x HisExpressionBacterialMutationP94R, E105K, E108Q, D160N, D165A, K190E, K196TPromoterT7Available SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP8m
Plasmid#162372PurposeMammalian expression of ultrafast protein calcium sensorDepositorInsertjGCaMP8m
Tags6xHisExpressionMammalianMutationA25G F286YPromoterCMVAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hLAMP2-C-GC6s
Plasmid#154151PurposeTo detect the calcium ion releases close to the lysosomal surfaceDepositorAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Rheb (Q64L)-pcw107
Plasmid#64607Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Gamma-Tubulin-17
Plasmid#55050PurposeLocalization: Centrosomes, Excitation: 587, Emission: 610DepositorAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Pink Flamindo
Plasmid#102356Purposebiosensor for cAMP in mammalian cellsDepositorInsertPink Flamindo
ExpressionMammalianPromoterCMVAvailable SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Vimentin-pLJM5
Plasmid#189868PurposeExpresses human Vimentin in mammalian cellsDepositorInsertVimentin
Tagsm-CherryExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-mCherry (AAV8)
Viral Prep#137132-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Fon-mCherry (#137132). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Fon-mCherry plasmid DNA. EF1a-driven, Cre and Flp-dependent expression of mCherry. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre and Flp-dependent)Available SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (AAV5)
Viral Prep#100833-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (#100833). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOSIP-KO (KanR, 186)
Plasmid#45985DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-SP1
Plasmid#232649Purposeexpresses SP1 in mammalian cellsDepositorAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Sec61b-C1
Plasmid#90994PurposeExpresses mCherry-tagged Sec61b, brightly labels endoplasmic reticulum in mammalian cellsDepositorInsertmCherry-Sec61b (SEC61B Synthetic, Human)
TagsmCherry (red fluorescence)ExpressionMammalianPromoterCMVAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-flag-YTHDF2
Plasmid#52300Purposefull length YTHDF2 with N-terminal flag tag for mammalian cell expressionDepositorAvailable SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FGFR2
Plasmid#116741PurposeLentiviral expression of FGFR2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iG2
Plasmid#27341DepositorInsertSFFV promoter, IRES-eGFP
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Hygro (656-4) (Lentiviral Prep)
Viral Prep#17446-LVPurposeReady-to-use Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA. Lentiviral particles carrying the GFP and hygromycin resistance.DepositorAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
BirA His-tag pLEMO
Plasmid#119817PurposeExpress endogenous biotin ligase in E.coliDepositorInsertBiotin ligase
Tags6-Histidine-tagExpressionBacterialAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_25bpLinker
Plasmid#157788PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 25 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_25bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMVR8.74
Plasmid#22036Purpose2nd generation lentiviral packaging plasmid. Can be used with 2nd or 3rd generation lentiviral vectors and envelope expressing plasmid (Addgene#12259)DepositorInsertgag pol tat rev
ExpressionMammalianAvailable SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mNeptune2.5
Plasmid#51310PurposeExpresses far-red fluorescent protein mNeptune2.5 in mammalian cellsDepositorInsertmNeptune2.5
ExpressionMammalianPromoterCMVAvailable SinceApril 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
sortase A pentamutant (eSrtA) in pET29
Plasmid#75144Purposeevolved sortase A (eSrtA) pentamutant with improved kinetics and activityDepositorInsertsortase A pentamutant
Tags6x HisExpressionBacterialMutationP94R, D160N, D165A, K190E, K196T. Deleted amino a…PromoterT7Available SinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCVSN2c-MCP-oScarlet-KASH-6xMS2 Barcode Library
Pooled Library#227672PurposeRVdG genome plasmids that carry an error-correctable barcode compatible with 3’ capture single cell or single nuclei RNA sequencing readout. For the production of CVS N2c strain G-deleted rabies virusDepositorExpressionMammalianSpeciesSyntheticAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
mAIRN HO
Plasmid#207411PurposeMammalian-cell-based plasmid system that expresses mAIRN (an R-loop-forming transcript) upon dox-induction, which will further cause head-ON transcription-replication conflict (HO TRC).DepositorInsertmAIRN
ExpressionBacterial and MammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
mAIRN CD
Plasmid#207412PurposeMammalian-cell-based plasmid system that expresses mAIRN (an R-loop-forming transcript) upon dox-induction, which will further cause co-directional transcription-replication conflict (CD TRC).DepositorInsertmAIRN
ExpressionBacterial and MammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2-mCherry (AAV8)
Viral Prep#137144-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Coff/Fon-ChR2-mCherry (#137144). In addition to the viral particles, you will also receive purified pAAV-nEF-Coff/Fon-ChR2-mCherry plasmid DNA. nEF-driven, Flp-dependent expression of ChR2-mCherry for optogenetic activation (inhibited in presence of Cre). These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsmCherry (Flp-dependent)Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-opti
Plasmid#106280PurposeA version of the CROP-seq plasmid as presented in Datlinger et al. that contains the sgRNA-(F+E)-combined optimized backbone for CRISPRi from Chen et al.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
AKT-translocation-mStrawberry reporter
Plasmid#158685PurposeThis plasmid is a AKT pathway reporter. It has 1EF1a promoter driving the expression of truncated FoxO1 fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
ECFP HO
Plasmid#207413PurposeMammalian-cell-based plasmid system that expresses ECFP (a non R-loop-forming transcript) upon dox-induction, which will further cause head-ON transcription-replication conflict (HO TRC).DepositorInsertECFP
ExpressionBacterial and MammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
ECFP CD
Plasmid#207414PurposeMammalian-cell-based plasmid system that expresses ECFP (a non R-loop-forming transcript) upon dox-induction, which will further cause co-directional transcription-replication conflict (CD TRC).DepositorInsertECFP
ExpressionBacterial and MammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Parkin
Plasmid#23956PurposeMammalian expression of human Park2 fused to mCherryDepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pOpen-MMLV_RT (mut H)
Plasmid#165546PurposeSingle 75 kDa monomer, cDNA synthesis; high enzyme activity and processivity.DepositorInsertMoloney Murine Leukemia Virus (MMLV) Reverse Transcriptase (RNAse H deactivated by 3 mutations)
UseSynthetic BiologyAvailable SinceAug. 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB_tre_Cas9
Plasmid#126029PurposePiggyBac cargo vector expressing doxycycline inducible Cas9DepositorInsertshumanized S. pyrogenes Cas9
Hygromycin resistance
UseCRISPR; PiggybacExpressionMammalianPromoterEF1 alpha and TREAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV.rTH.PI.Cre.SV40 (AAV9)
Viral Prep#107788-AAV9PurposeReady-to-use AAV9 particles produced from AAV.rTH.PI.Cre.SV40 (#107788). In addition to the viral particles, you will also receive purified AAV.rTH.PI.Cre.SV40 plasmid DNA. rTH promoter driving Cre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterrTHAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only