We narrowed to 14,123 results for: cas9 genes
-
Plasmid#133967PurposeExpresses HF-BE3 CRISPR base editor and gRNA scaffold in StreptomycesDepositorArticleInsertHF-BE3
UseCRISPR and Synthetic BiologyAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro-Chen-tracrRNA_2xBsmBI
Plasmid#196710PurposeBackbone for cloning single guides (Chen tracrRNA PMID: 24360272) or guide libraries with untranscribed barcodes and a tracrRNA of choiceDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-EMX1+38
Plasmid#140579PurposeExpresses a pegRNA in mammalian cellsDepositorInsertpegRNA EMX1 +38
Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
reporter-gT2
Plasmid#47321PurposeTF reporter for gRNA-AAVS1_T2 (RNA-guided dTomato expression)DepositorInsertminCMV-dTomato_pA
UseCRISPRAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-VEGFA
Plasmid#140588PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA VEGFA
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-DNMT1+38
Plasmid#140578PurposeExpresses a pegRNA in mammalian cellsDepositorInsertpegRNA DNMT1 +38
Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-CACNG3
Plasmid#140590PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA CACNG3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHu6-gRNA-NT1
Plasmid#81203PurposehU6 expression of gRNA NT1DepositorInserthU6 expression of gRNA NT1
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-gate
Plasmid#113758PurposeGateway destination vector only containing the Gateway cassette and pGEM-T Easy backbone. This can be used with Gateway-compatible Homology-Directed Repair.DepositorInsertgateway cassette
UseGateway destination vectorAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-ALDH1A3
Plasmid#140589PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA ALDH1A3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA5
Plasmid#100557PurposeExpresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGCDepositorInsertMYC sgRNA5
PromoterU6Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
EMX1_sgRNA
Plasmid#100555PurposeExpresses EMX1 sgRNA. Target sequence: GAGTCCGAGCAGAAGAAGAADepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-SYNPO
Plasmid#140587PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA SYNPO
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA4
Plasmid#100556PurposeExpresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAGDepositorInsertMYC sgRNA4
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP608-1
Plasmid#99484PurposeH2B::linker::GFP (contain 3 introns)::3XFlag::TEV::Myc::tbb-2 3UTRDepositorInsertH2B::linker::GFP with introns::3XFlag::TEV::Myc::tbb-2 3UTR
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDD401
Plasmid#91828PurposePmyo-2::GFP FP-slot donor for the SapTrap cloning systemDepositorInsertPmyo-2::GFP
UseCRISPRExpressionWormMutationNucleotide 489 of the myo-2 promoter was changed …Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-TREX2-N
Plasmid#244025PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-AtEXO1B-N
Plasmid#244024PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB109
Plasmid#223017PurposeCas9 and Csy4 with 5' and 3' targets (II) for Lotus callus assayDepositorInsertCas9 and Csy4 with 5' and 3' targets (II)
UseCRISPRExpressionPlantAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB105
Plasmid#223016PurposeCas9 and Csy4 with 5' and 3' targets (I) for Nicotiana leaf assayDepositorInsertCas9 and Csy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
nNc-ABE
Plasmid#194095PurposeCMV-TadA 8e-nNcCas9. A-to-G base editing in human cells.DepositorInsertTadA 8e-nNcCas9
ExpressionMammalianMutationNcCas9 D16APromoterCMVAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-RGS8
Plasmid#140585PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA RGS8
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-GTPBP2
Plasmid#140586PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA GTPBP2
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF525-AcrIIA14-truncated_gb85_Cand9-trunc_lenti
Plasmid#138312PurposeLenti expression of AcrIIA14, C-terminusDepositorInsertAcrIIA14, C terminus
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v1)-PGK-Puro-BFP
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAP1071-2
Plasmid#99502Purpose3XFlag::meGFP with 2 introns::Ollas::H2B::tbb-2 3utr::linker::TEVDepositorInsert3XFlag::meGFP with 2 introns::Ollas::H2B::tbb-2 3’utr::linker::TEV
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRAvailable SinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRExpressionMammalianPromoterCMV, U6, and hPGKAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ENL)
Plasmid#69212PurposeLentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; MLL-ENL,(t[11;19])DepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro HEK3 CTT ins
Plasmid#171995PurposeDelivers all prime editing nuclease components targeting the HEK3 gene for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertHEK3 CTT insertion pegRNA and CbH-Cas9-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA sham
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceSept. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS1099: Dual-sgRNA.Design 4
Plasmid#159537PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 with two guide RNA cassettes
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro-HEK3 CTT ins
Plasmid#171996PurposeDelivers all prime editing (nickase) components targeting the HEK3 site for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA HEK3 +90
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLoxP-DHFR-mCherry
Plasmid#70147PurposeExpresses a DHFR-mCherry fusion protein and uses for a CRISPR gene deletionDepositorInserta selectable dihydrofolate reductase-thymidylate synthase marker
UseExpression in toxoplasma gondiiTagsmCherryPromoterDHFR 5' UTRAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUREF-EX
Plasmid#199331PurposeA pEF-BOS-EX-derived expression vector that contains an SV40 promoter-driven puromycin resistance geneDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC_sgRNA
Plasmid#68710PurposeContains the sgRNA backbone sequence (tracrRNA, 82 bp) and is used as DNA template to amplify a specific sgRNA using a forward primer with the protospacer sequence for gene targeting.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceSept. 14, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRIS-PITChv2-FBL
Plasmid#63672PurposePITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locusDepositorInsertEGFP-2A-PuroR
UseCRISPRPromoterPromoterlessAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAGM47523
Plasmid#153221PurposeLevel 0 zCas9i vectorDepositorInsertSpCas9 with introns and 2 NLS
UseSynthetic BiologyAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV643
Plasmid#226182PurposeExpresses a color marker (uidA) cassette for disruption on KU70 gene in K. phaffii.DepositorInsertuidA marker flanked with targeting regions to KU70 gene in K.phaffii
ExpressionBacterialPromoterTEF1pAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-sgRNA(MS2)
Plasmid#102560PurposePiggybac transposon sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
P4 cosmid
Plasmid#196335PurposeP4 cosmid with CRISPR-Cas9 systemDepositorInsertgenes from phage P4, CRISPR-Cas9 system
UseCRISPRExpressionBacterialAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only