We narrowed to 5,645 results for: SUP
-
Plasmid#53566PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-Q175
UseTagsExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable sinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160)
Plasmid#75412PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19DepositorInsertRenilla / P19
UseLuciferase and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pS6-TGFB2-STREP
Plasmid#128503PurposeExpresses human pro-TGFβ2 (from L21 to S414) in mammalian cells. With N-t STREP(2x) tag.DepositorInsertTGFB2 (TGFB2 Human)
UseTagsSTREP (2X) tagExpressionMammalianMutationPromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV KSR2 IRES GFP
Plasmid#25969DepositorInsertKinase suppressor of Ras 2 (Ksr2 Mouse)
UseRetroviralTagsFlagExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-Dendra2-Puro
Plasmid#169217PurposeTargeting vector backbone to support a knock-in of Linker-Dendra2-P2A-Puro at the C-terminus of a target locusDepositorInsertDouble SapI flanked Dendra2-P2A-Puro
UseTargeting vector backboneTagsExpressionMutationPromoterAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight S174
Plasmid#53567PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-S174
UseTagsExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable sinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Islr2.b-Fc-His
Plasmid#72077PurposeExpresses the extracellular region of the Islr2.b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertIslr2.b (Islr2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Islr2.b-AP-His
Plasmid#71951PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertIslr2.b (Islr2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-Fc-His
Plasmid#72081PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertJam4.1 (Igsf5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LtR-wt(TAG)
Plasmid#217366PurposeExpresses E. coli leucine tRNA and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA for TAG suppression
UseAAVTagsExpressionMammalianMutationPromoterU6Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET303C-hSOD1 A4V/C6S
Plasmid#139667PurposeExpression plasmids containing human A4V/C6S SOD1DepositorInsertSuperoxide dismutase-1 (SOD1 Human)
UseTagsExpressionBacterialMutationchange alanine 4 to valine, change cysteine 6 to …PromoterT7Available sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorUseTagsExpressionMammalianMutationPromoterU6 and chicken beta-actin promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S22A S23A-msfGFP
Plasmid#180338Purposemammalian expression of human SEPT9_i1 S22A S23A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
UseTagsmsfGFPExpressionMammalianMutationSEPT9_i1 S22A S23APromoterCMVAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R10A R15A-msfGFP
Plasmid#180336Purposemammalian expression of human SEPT9_i1 R10A R15A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
UseTagsmsfGFPExpressionMammalianMutationSEPT9_i1 R10A R15APromoterCMVAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S12A S13A-msfGFP
Plasmid#180337Purposemammalian expression of human SEPT9_i1 S12A S13A fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
UseTagsmsfGFPExpressionMammalianMutationSEPT9_i1 S12A S13APromoterCMVAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO GLTP
Plasmid#170732PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorInsertGLTP (GLTP Human)
UseTagsSUMOExpressionBacterialMutationPromoterAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB61 - pL0_V2 (CDS1)
Plasmid#123183PurposeGolden Gate (MoClo; CDS1) compatible Tomato yellow leaf curl virus (TYLCV) V2 silencing suppressor based on NCBI Reference Sequence NC_004005DepositorInsertTomato yellow leaf curl virus (TYLCV) V2 (v2 Synthetic)
UsePart for plant expressionTagsExpressionPlantMutationNo BpiI and BsaI sitesPromoterAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertJam4.3 (Igsf5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertJam4.1 (Igsf5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-AP-His
Plasmid#71956PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertJam4.3 (Igsf5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C
Plasmid#60394PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) C130S, E446C for crosslinking polyglutamate peptideDepositorInsertTUB1 (TUB1 Synthetic, Budding Yeast)
UseTagsExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
UseTagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available sinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc-LATS1
Plasmid#66851PurposeExpress Myc-tagged LATS1 in mammalian cellsDepositorInsertLATS1 (LATS1 Human)
UseTagsMycExpressionMammalianMutationP44L mutation in LATS1 compared to GenBank refere…PromoterCMVAvailable sinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK302
Plasmid#87768PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be usedDepositorInsertsPrhaBAD-sfGFP
rhaS from E. coli with its native RBS from E. coli
UseSynthetic BiologyTags6xHis TagExpressionBacterialMutationPromoterPrhaBAD rhamnose-inducible promoter from E. coli …Available sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-msfGFP_SEPT6
Plasmid#174498Purposebacterial co-expression of human SEPT2 fused to monomeric superfolder GFP and of human SEPT6DepositorUseTagsHis6-TEV and msfGFPExpressionBacterialMutationPromoterAvailable sinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_msfGFP-SEPT7
Plasmid#180315Purposemammalian expression of human SEPT7 fused to monomeric superfolder GFPDepositorInsertSEPTIN7 (SEPTIN7 Human)
UseTagsmsfGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ucp1-Cre-miR122
Plasmid#228408PurposeExpression of Cre recombinase from a rat Ucp1 enhancer-promoter. Contains miR122 target sequences that suppress expression in hepatocytes.DepositorInsertscre recombinase with SV40 NLS
Cre recombinase with SV40 NLS
UseAAVTagsExpressionMutationPromoterrat Ucp1 enhancer-promoterAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc sfCherry2ΔC4-Lifeact
Plasmid#231557PurposeMammalian expression of Lifeact fused to C-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertLifeact (ABP140 Budding Yeast)
UseTagssfCherry2ExpressionMammalianMutationPromoterCMVtruncAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro shKRAS
Plasmid#116871PurposeTet-inducible suppression of KRASDepositorInsertshKRAS (KRAS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TOAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT2-msfGFP
Plasmid#180318Purposemammalian expression of human SEPT2 fused to monomeric superfolder GFPDepositorInsertSEPTIN2 (SEPTIN2 Human)
UseTagsmsfGFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2.4-sfGFP
Plasmid#149666PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2.4DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2-sfGFP
Plasmid#145173PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v6-sfGFP
Plasmid#145177PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 6DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDam-Myc-HP1
Plasmid#59221Purposeexpresses Dam-myc-HP1DepositorInsertHP1 (Su(var)205 Fly)
UseDamidTagsDam and mycExpressionInsectMutationPromoterDrosophila heat shock promoterAvailable sinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v1-sfGFP
Plasmid#145172PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 1DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-D387A
Plasmid#59778PurposeExpresses optoFGFR1 with mutation in PHR to suppress homointeraction, thus cannot be activated by lightDepositorInsertOptoFGFR1-D387A (FGFR1 Mustard Weed, Human)
UseTagsmCitrineExpressionMammalianMutationPromoterCMVAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v3-sfGFP
Plasmid#145174PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 3DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v5-sfGFP
Plasmid#145176PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 5DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v4-sfGFP
Plasmid#145175PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 4DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2.2-sfGFP
Plasmid#149665PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2.2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2-T92Q-sfGFP
Plasmid#145178PurposeMammalian expression plasmid for sACE2-sfGFP glycosylation mutant T92QDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
SOBIR1 X010_pECIA2
Plasmid#115075PurposeBait vector SOBIR1 X010_pECIA2 should be used with prey vector SOBIR1 X010_pECIA14.DepositorInsertAT2G31880 (SOBIR1 Mustard Weed)
UseTagsFc, V5 and hexahistidine tagsExpressionInsectMutationPromoterMetallothionein (Copper-Inducible)Available sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOBIR1 X010_pECIA14
Plasmid#114875PurposePrey vector SOBIR1 X010_pECIA14 should be used with bait vector SOBIR1 X010_pECIA2.DepositorInsertAT2G31880 (SOBIR1 Mustard Weed)
UseTagsExpressionInsectMutationPromoterMetallothionein (Copper-Inducible)Available sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI1
Plasmid#217367PurposeExpresses E. coli leucine tRNA variant "LeuIGI1" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI1" for TAG suppression
UseAAVTagsExpressionMammalianMutationG6U, C78G, U83CPromoterU6Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVTagsExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-KSR1-CA3 (N-KSR)
Plasmid#217755PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseTagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterCMVAvailable sinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKSR1-CA3-GS-mRFP1 (C-KSR-GS)
Plasmid#217758PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseTagsmRFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable sinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only