We narrowed to 7,002 results for: tet
-
Plasmid#169741PurposeCMV+ plasmid that also encodes a separate mCherry cassette. mCherry is used to monitor plasmid dosage.DepositorInserteGFP
UseSynthetic BiologyExpressionMammalianPromoterpCMV-tetO2Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
enz.083-NMT1
Plasmid#154047PurposeExpresses NMT1 in E. coliDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFRS2IP
Plasmid#156012PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PPIB
Plasmid#155838PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PGK+ plasmid with onboard mCherry cassette
Plasmid#169745PurposePGK+ plasmid that also encodes separate mCherry cassette. mCherry is used to monitor plasmid dosage.DepositorInserteGFP
UseSynthetic BiologyExpressionMammalianPromoterPGK-tetO2Available SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTSSX-STC
Plasmid#115668PurposeE.coli expression plasmid of small tetraheme cytochrome (STC) from Shewanella oneidensis MR-1 with cleavable Strep tagDepositorInsertsmall tetraheme cytochrome c
TagsSignal peptide (aa1-27)-Strep-II tag- Factor Xa c…ExpressionBacterialPromotertacAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB-TAG-HES7
Plasmid#130935PurposePiggyBac vector for DOX-inducible human HES7-IRES-EGFP expression in mammalian cellsDepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
ZNF9
Plasmid#156152PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
INTS6
Plasmid#155681PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB222
Plasmid#170012PurposeEncodes LacI-controlled expression of surface-displayed LL-37 and PvirK-mNeonGreen reporterDepositorArticleInsertsmNeonGreen
LL-37
UseSynthetic BiologyTagsLpp, OmpA, and TetherExpressionBacterialPromoterPtac and PvirKAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
DHX37
Plasmid#155539PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
EXOSC10
Plasmid#155589PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)::RAM-d2tTA
Plasmid#189627PurposeExpresses hM3D(Gq) under the hSyn promoter, and d2tTA under the pRAM (synthetic Fos) promoter. Plasmid 1 for recording Fos expression.DepositorInsertshM3D(Gq)
d2tTA
UseAAVTagsHAExpressionMammalianPromoterhSyn and pRAMAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP EGFP-ER [TM(SAC1)]
Plasmid#186475PurposeExpression of the Endoplasmic Reticulum marker GFP-ER [TM(SAC1)] in mammalian cellsDepositorInsertSAC1 (SACM1L Human)
UseRetroviralTagsEGFPExpressionMammalianMutationC-terminal transmembrane region of the protein: 5…Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
mApple-M1 SpastinK388R
Plasmid#134463PurposeM1 SpastinK388R expressionDepositorInsertM1 Spastin (SPAST Human)
ExpressionMammalianMutationLys to Arg at amino acid 388PromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
LN-entry+NLS
Plasmid#128011PurposeVector containing the lambdaN-entry expression cassette with SV40 NLS and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertLN-3xFlag-SV40NLS
UseLamdan entry vector with nls to generate tetherin…TagsLN-3xFlag-SV40NLSAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-GGS4X-GFP
Plasmid#108583PurposeExpresses PKAcs-GFP fusion in mammalian cells with flexible linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p5067 pOZN E2TR
Plasmid#14446DepositorInsertE2TR
UseRetroviralTagsFlag and HAExpressionMammalianAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
SNW1
Plasmid#156034PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
ExpressionMammalianAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald D40G
Plasmid#164211PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 D40G mutant under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET48 AtGUN1-PS
Plasmid#136358PurposeBacterial expression of recombinant Arabidopsis thaliana GUN1 (amino acids 232 to 918)DepositorInsertcDNA of Arabidopsis thaliana GUN1 corresponding to amino acids 232 to 918 (GUN1 Mustard Weed)
TagsTRX-HisExpressionBacterialPromoterT7Available SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-ARshRNA2
Plasmid#220562PurposeTo inducibly knockdown AR expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRB1 CTF-FLAG
Plasmid#217681PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRB1 (ADGRB1 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-926Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-CRY2oligo-mcherry-ANXA11(R235Q)
Plasmid#164205PurposeExpresses CRY2oligo-mcherry tagged ANXA11 R235R mutant under CMV promoterDepositorInsertANXA11 (ANXA11 Human)
TagsCRY2oligo-mcherryExpressionMammalianMutationR235QPromoterCMVAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-CRY2oligo-mcherry-ANXA11(D40G)
Plasmid#164204PurposeExpresses CRY2oligo-mcherry tagged ANXA11 D40G mutant under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
KA2880_pPB-TREtight-FLAG-Esrrb-InO
Plasmid#124178PurposepiggyBac-based Dox-inducible expression of FLAG-EsrrbDepositorAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA2
Plasmid#220578PurposeTo inducibly knockdown CCND1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Gal4-entry+NLS
Plasmid#128013PurposeVector containing the Gal4-entry expression cassette with SV40 NLS and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertGal4 DBD-SV40NLS-3x-Flag
UseGal4 entry vector with nls to generate tethering …TagsGal4-DBD-SV40NLS-3xFlagAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
HL 818 (=HL 716 + pHL 98)
Plasmid#30006DepositorInsertpLlacO-1:DsrA-mcherry, pLtetO-1:rpoS::gfp
UseSynthetic BiologyTagsmcherry, GFPExpressionBacterialAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-MAFF
Plasmid#192917PurposeBarcoded piggybac transposon vector with Dox-inducible expression of MAFFDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMX-53BP1(1-1710) 3LA
Plasmid#185698PurposeMammalian Expression, Retroviral vector that encodes a 3LA mutant of 53BP1 that disrupts three RIF1-binding motifs and abolishes the 53BP1-dependent recruitment of RIF1 to DNA double-strand breaks.DepositorInsert53BP1(1-1710) 3LA (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationL175A, L517A, and L693APromoterSV40Available SinceJuly 7, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRS423-mitoT
Plasmid#174525PurposeExpresses yeast variant of mitoT synthetic intermembrane tether bridging the inner and outer mitochondrial membranesDepositorInsertYeast mitochondrial intermembrane tether
UseSynthetic BiologyTagseGFPExpressionYeastPromoterMET25Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-NHA-Ago2
Plasmid#115361PurposeExpression vector to produce NHA-tagged human Ago2 proteinDepositorAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
p5A0-T
Plasmid#92016PurposeExpresses TALE targeted to lac operator without TEV cut sites, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VPromoterJ23102 Promoter (from Anderson promoter library) …Available SinceJan. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-KNL1-rvsf_aaaa-dCas9
Plasmid#248567PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertKNL1-rvsf_aaaa-dCas9
UseCRISPRTagsHA, 2xNLSExpressionMammalianMutationKNL1 RVSF58-61AAAA; Cas9 D10A, H840APromoterCMV, TetO2Available SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-SUMO2nc-PURO
Plasmid#208043PurposeEnables inducible expression of low-affinity Avitag-SUMO2nc; to perform bioE3; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO2nc (SUMO2 Human)
UseLentiviralTagsLow-affinity AvitagMutationQ90P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-NR1H2
Plasmid#192919PurposeBarcoded piggybac transposon vector with Dox-inducible expression of NR1H2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-WT1
Plasmid#192906PurposeBarcoded piggybac transposon vector with Dox-inducible expression of WT1DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-SUMO1nc-PURO
Plasmid#208042PurposeEnables inducible expression of low-affinity Avitag-SUMO1nc; to perform bioE3; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsLow-affinity AvitagMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMX-53BP1(1-1710) 3LA7A
Plasmid#185707PurposeMammalian Expression, Retroviral vector that encodes 7A and 3LA mutant of 53BP1. Prevents shieldin and RIF1 recruitment to sites of double-strand breaks and disrupts 53BP1 activity.DepositorInsert53BP1(1-1710) 3LA7A (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationT302A, S452A, S523A, S543A, S625A, S784A, and S89…PromoterSV40Available SinceJuly 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
p5072 pcDNA4c hBrd4 (1224-1362)
Plasmid#14451DepositorAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
p5080 pcDNA4c hBrd4 (1134-1362)
Plasmid#14456DepositorAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBJG1 T7-8xHis-OGT 5N5A
Plasmid#154280PurposeBacterial expression of full length human OGT with 5N5A TPR mutations (inefficient substrate binding). N-terminal T7_leader-8xHis tag followed by HRV3C protease site.DepositorInsertO-GlcNAc Transferase (OGT Human)
Tags8x His, HRV3C protease site, and T7 leaderExpressionBacterialMutationN322A, N356A, N390A, N424A, N458A mutations; bact…Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD-MHC
Plasmid#113957Purposemammalian expression plasmid for FLAG-tagged human T1R2 ECD with signal peptide of influenza hemagglutinin fused to a canonical transmembrane domain from MHC class IDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG, Signal/leader sequence from influenza hemag…ExpressionMammalianMutationresidues 22-568 fused to a transmembrane tetherPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-EB-C5
Plasmid#80485PurposepiggyBac transposon for dox-inducible expression of the EB-C5 polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-c-myc-optiT1R3 ECD-MHC
Plasmid#113961Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 extracellular domain with signal peptide of HLA class I histocompatibility antigen A-2 alpha chain fused to a canonicalDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-563 fused to a transmembrane tetherPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAU002 - pTRE3G-CTCF(DELTA1-265)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156429PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationDELTA1-265Available SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only