We narrowed to 9,706 results for: Gnas
-
Plasmid#238009PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorInsertOpn5 (OPN5 Chicken)
UseAAV and Cre/LoxTagsExpressionMutationPromoterEF1αAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Human Wild-type ASAP1
Plasmid#235212PurposeExpresses Wild-Type ASAP1 in mammalian cellsDepositorInsertASAP1 (ASAP1 Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-dN40-TP53-CCRB
Plasmid#236774PurposeA piggybac-based cloning vector containing TRE3G promoter-driven short-form of TP53 and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.DepositorInsertTP53 (TP53 Human)
UsePiggybacTagsExpressionMammalianMutationdeleted amino acids 1-40PromoterTRE3G promoter and TRE3G promoter, CAG promoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mCherry-P2A-EIF3D-DD-IP
Plasmid#236770PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D S528D/S529D-IRES-Pac.DepositorInsertEIF3D (EIF3D Human)
UseSleeping beautyTagsExpressionMammalianMutationchanged Serine 528 to Aspartic Acid and Serine 52…PromoterCAG promoterAvailable sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB_sgRBBP6-68
Plasmid#237555PurposeA piggybac-based vector containing mouse U6 promoter-driven RBBP6 sgRNA #6, human U6 promoter-driven RBBP6 sgRNA #8 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertRBBP6 (RBBP6 Human)
UsePiggybacTagsExpressionMammalianMutationPromotermouse U6 promoter and mouse U6 promoter, human U6…Available sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM1 WPRE
Plasmid#236233PurposeAAV expression of mouse STIM1 internally tagged with HaloTagDepositorInsertHaloTag-Stim1 (Stim1 Mouse)
UseAAVTagsHaloTagExpressionMutationPromoterhuman Synapsin 1Available sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorInsertmEmerald-Stim1 (Stim1 Mouse)
UseAAVTagsmEmeraldExpressionMutationPromoterhuman Synapsin 1Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220613PurposeCre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianMutationPromoterEF1aAvailable sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-EREG-ScNeo
Plasmid#209909PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-miRFP703-eDHFR(69K6)-cRaf
Plasmid#209919PurposeMammalian expression of cRaf fused to miRFP703-eDHFR(69K6)DepositorInsertmiRFP703-eDHFR(69K6)-cRaf (RAF1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-miRFP703-eDHFR(69K6)-cRaf
Plasmid#209920PurposeMammalian expression of cRaf fused to miRFP703-eDHFR(69K6)DepositorInsertmiRFP703-eDHFR(69K6)-cRaf (RAF1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-miRFP703-eDHFR(69K6)-cRaf
Plasmid#209921PurposeMammalian expression of cRaf fused to miRFP703-eDHFR(69K6)DepositorInsertmiRFP703-eDHFR(69K6)-cRaf (RAF1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-HBEGF-ScNeo
Plasmid#209903PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertHBEGF-ScNeo (HBEGF Human)
UseTagsmNeonGreen and mScarletExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-EREG-ScNeo
Plasmid#209905PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-HBEGF-ScNeo
Plasmid#209907PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertHBEGF-ScNeo (HBEGF Human)
UseTagsmNeonGreen and mScarletExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 7 deletion
Plasmid#224388PurposeLenti plasmid for generating GNB1L _WD 7 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
UseTagsExpressionBacterial and MammalianMutationWD 7 domain deleted (aa 286-323)PromoterAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 6 deletion
Plasmid#224387PurposeLenti plasmid for generating GNB1L _WD 6 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
UseTagsExpressionBacterial and MammalianMutationWD 6 domain deleted (aa 242-282)PromoterAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 4 deletion
Plasmid#224385PurposeLenti plasmid for generating GNB1L _WD 4 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
UseTagsExpressionBacterial and MammalianMutationWD 4 domain deleted (aa 153-195)PromoterAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-3xHA-hM3D(Gq)-P2A-ArgiNLS-oScarlet
Plasmid#220614PurposeCre-dependent co-expression of 3x HA-tagged excitatory hM3D(Gq) DREADD receptor, and a single-cell discriminating version of oScarlet as a reporter.DepositorInsert3x HA-hM3D(Gq)-P2A-AgiNLS-oScarlet
UseAAV and Cre/LoxTags3x HA; ArgiNLSExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron BQ.1.1
Plasmid#214725PurposeExpresses SARS-CoV-2 Omicron BQ.1.1 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorInsertReceptor-Binding Domain (S SARS-CoV-2)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Quartet-SpyTag
Plasmid#214726PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses SHC014, Rs4081, RaTG13, and SARS-CoV-2 each separated by GS-linkers with a C-terminal SpyTag fusionDepositorInsertQuartet-SpyTag (S Synthetic)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-Quartet
Plasmid#214727PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses SHC014, Rs4081, RaTG13, and SARS-CoV-2 each separated by GS-linkers with an N-terminal SpyTag fusionDepositorInsertSpyTag-Quartet (S Synthetic)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-Alternate Quartet
Plasmid#214728PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses pang17, RmYN02, Rf1, and WIV1 each separated by GS-linkers with an N-terminal SpyTag fusionDepositorInsertSpyTag-Alternate Quartet
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-Quartet [SARS1]
Plasmid#214729PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses SHC014, Rs4081, RaTG13, and SARS-CoV each separated by GS-linkers with an N-terminal SpyTag fusionDepositorInsertSpyTag-Quartet [SARS1] (S Synthetic)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-Kraken Quartet
Plasmid#214730PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses SHC014, Rs4081, RaTG13, and SARS-CoV-2 XBB.1.5 separated by GS-linkers with an N-terminal SpyTagDepositorInsertSpyTag-Kraken Quartet (S Synthetic)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-Quartet_NoLinker
Plasmid#214731PurposeIn mammalian cells expresses a Quartet of receptor-binding domains (RBDs) from the sarbecoviruses SHC014, Rs4081, RaTG13, and SARS-CoV-2 with no linkers between the RBDs and an N-terminal SpyTagDepositorInsertSpyTag-Quartet_NoLinker (S Synthetic)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Delta
Plasmid#214723PurposeExpresses SARS-CoV-2 Delta RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorInsertReceptor-Binding Domain (S SARS-CoV-2)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx32D178Y-IRES-GCaMP6s
Plasmid#216796PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of the D178Y mutant form of Connexin 32 and cytosolic GCaMP6sDepositorInsertCx32D178Y-IRES-GCaMP6s (GJB1 Human)
UseLentiviralTagsExpressionMutationD178Y mutant form of Connexin 32PromoterAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-CG-LYCHOS WT-HA-GFP
Plasmid#199687PurposeExpression of LYCHOS WT in insect cellsDepositorInsertLYCHOS (GPR155 Human)
UseTags10xHis, EGFP, HA, HRV 3C, and HisExpressionInsectMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) ∆DEP-HA
Plasmid#199683PurposeTransient expression of LYCHOS (GPR155) ∆DEP-HADepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationDEP domain deletedPromoterCMVAvailable sinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS (GPR155) Y551A-HA
Plasmid#199676PurposeTransient expression of LYCHOS (GPR155) Y551A mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationY551 mutated to APromoterCMVAvailable sinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a LZ LED WT-FLAG
Plasmid#199679PurposeBacterial expression of Leucine Zipper (LZ) LYCHOS LED-FlagDepositorInsertLeucine zipper LYCHOS LED WT (GPR155 Human)
UseTags6xHis and FlagExpressionBacterialMutationPromoterT7 promoterAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) P44A-HA
Plasmid#199675PurposeTransient expression of LYCHOS (GPR155) P44A mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationP44 mutated to APromoterCMVAvailable sinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) E48Q-HA
Plasmid#199662PurposeTransient expression of LYCHOS (GPR155) E48Q mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationE48 mutated to QPromoterCMVAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) F43I-HA
Plasmid#199674PurposeTransient expression of LYCHOS (GPR155) F43I mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationF43 mutated to IPromoterCMVAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dMET
Plasmid#176031PurposeA knock-out vector for dog METDepositorInsertA gRNA targeting the dog MET gene and the cDNA of Cas9 (MET )
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-R/G-ICUE
Plasmid#181849PurposeICUE cAMP sensor using sfGFP and mRuby2 as the FRET donor and acceptor.DepositorInsertR/G-ICUE (RAPGEF3 Human)
UseTagsmRuby2 and sfGFPExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
SOD1_pcDNA6.2/EmGFP-Bsd
Plasmid#176964PurposeMammalian expression vector encoding SOD1 and EmGFP-BsdDepositorInsertSOD1 (SOD1 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorUseTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…PromoterAvailable sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorUseTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…PromoterAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
JDW 249 (pTol2-Dll4-F2-ETS#2-WT-8X-E1b-EGFP)
Plasmid#156417Purpose8X copies of the ETS#2 site of the murine Dll4 intronic enhancer and a minimal E1b reporter driving expression of EGFP flanked by Tol2 sitesDepositorInsertmurine Dll4 F2-6/F8 ETS site B/ site #2, 8X
UseZebrafish transgenesisTagsExpressionMutationPromoterE1b min pro/b-globin intronAvailable sinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA8-Flag-LARS (361-720aa)
Plasmid#139688PurposeExpresses N-teminal Flag tagged aa 361-720 of LARS1DepositorInsertLARS1 (LARS1 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-FRT-T0-RNF168 delta MIU1/MIU2
Plasmid#133980Purposeinducible mammalian expression vector of eGFP tagged RNF168 where both motifs interacting with ubiquitin have been deletedDepositorInsertRNF168 (RNF168 Human)
UseTagseGFPExpressionMammalianMutationdeletion of MIU1 and MIU2PromoterCMVAvailable sinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBABE-RSLID1(WT)
Plasmid#122296Purposeexpresses RSL1D1 protein in mammalian cells (puro resistance)DepositorInsertRSL1D1 (RSL1D1 Human)
UseRetroviralTagsExpressionMammalianMutationPromotervector's LTRAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mcherry Gamma 9 in pcDNA3.1
Plasmid#64208PurposemCherry fused between Cry2 and gamma 9 to study cell migrationDepositorUseTagsmcherry and n/aExpressionMammalianMutationPromoterCMVAvailable sinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-10-3xFLAG-LGP2-MIIa
Plasmid#58684PurposeExpresses LGP2 with a mutation to motif IIa in mammalian cellsDepositorInsertLGP2-MIIa (DHX58 Human)
UseTags3x FLAGExpressionMammalianMutationmutation to Motif IIA, K138E and Y142FPromoterCMVAvailable sinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-D-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232947PurposeExpresses the domain-mutant YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-D-MUT (YTHDF2 Human)
UseLentiviralTagsExpressionMutation5 site mutation (Y418A+D422A+W432A+W486A+W491A), …PromoterAvailable sinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2 (nonsense mutation of sgYTHDF2-1)
Plasmid#232945PurposeExpresses YTHDF2 with synonymous mutations rendering it resistant to sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2 (YTHDF2 Human)
UseLentiviralTagsExpressionMutationsynonymous mutationPromoterAvailable sinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-m(6)A-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232946PurposeExpresses the m6A-binding-deficient mutant of YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-m(6)A-MUT (YTHDF2 Human)
UseLentiviralTagsExpressionMutation2 site mutation (W432A+W486A), synonymous mutationPromoterAvailable sinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only