We narrowed to 12,322 results for: BASE
-
Plasmid#69769PurposeThisbe (FGF8-like-1) Ligand in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertThisbe (FGF8like-1)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutationEncodes amino acids 1-739 of Thisbe (NP_610701.2)…Promoterhsp70 promoterAvailable sinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-miRFP670-C
Plasmid#159438PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorInsertmiRFP670
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…ExpressionMutationPromoterCMVAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-EGFP-C
Plasmid#159436PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorInsertEGFP
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…ExpressionMutationPromoterCMVAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 integrase (GB1496)
Plasmid#160578PurposeStreptomyces phage PhiC31 integrase, complete CDSDepositorInsertPhiC31
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-synPCB2.0
Plasmid#139477PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Fnr-Fd-T7
UseTagsExpressionMammalianMutationV413LPromoterCAG promoterAvailable sinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX601‐mhCMV‐ABEmaxNGA‐C3‐ E53ogRNA
Plasmid#187063PurposeNpu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutationDepositorInsertNpu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutation
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermhCMVAvailable sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
JBEI-3716
Plasmid#100169PurposeUsed to improve production from engineered biosynthetic pathways include optimizing codon usage, enhancing production of rate-limiting enzymes, and eliminating the accumulation of toxic intermediates or byproducts to improve cell growthDepositorInsertcodon-optimized MK
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
LC501: pMVP (L3-L2) mCherry + polyA
Plasmid#121765PurposepMVP L3-L2 entry plasmid, contains mCherry + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term mCherry fusion to gene of interest.DepositorInsertmCherry + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JP705: pMVP/SB/Neo-DEST
Plasmid#121866PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ Neo selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…TagsExpressionMammalianMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP306-pAAV-EFS-MCS3-pA
Plasmid#113682PurposeEFS driven Multi Cloning Site-3.DepositorInsertN/A
UseAAVTagsExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha1 Pnos:PhiC31int:Tnos (GB1531)
Plasmid#160616PurposeTU for the constitutive expression of Streptomyces phage PhiC31 integrase.DepositorInsertPhiC31
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.8
Plasmid#133521PurposesfGFP driven by a T7 promoter with the tetO sequence 11 bp downstream from the promoter start siteDepositorInsertsfGFP
UseTagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Keasling-2337
Plasmid#100168PurposeUsed to improve production from engineered biosynthetic pathways include optimizing codon usage, enhancing production of rate-limiting enzymes, and eliminating the accumulation of toxic intermediates or byproducts to improve cell growthDepositorInsertlacIq-Ptrc-ADS
UseTagsExpressionBacterialMutationPromotertrcAvailable sinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVRa12_807
Plasmid#49663DepositorInsertECF12_807
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable sinceJan. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRSETa-mEos4b-V69T
Plasmid#98572Purposephotoconvertible fluorescent protein mEos4b-V69T in pRSetA plasmid, photoconvertible by primed conversion mechanism, bacterial overexpressionDepositorInsertmEos4b-V69T
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceMarch 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
KP201: pMVP (L5-L4) eGFP-P2A
Plasmid#121708PurposepMVP L5-L4 entry plasmid, contains eGFP-P2A for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term eGFP linked by P2A to gene of interest.DepositorInserteGFP-P2A (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB027
Plasmid#119712PurposeMultipartite assembly obtained by combining FB parts FB026+FB003 into pDGB3omega1. Used for fluorescent tagging of fungi (Hyg resistance +YFP) according to FungalBraid modular DNA assembly for ATMTDepositorInsertPgpdA::YFP::TtrpC(←)-PtrpC::hph::Ttub (→)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
cycLuc_SbMVs
Plasmid#119209PurposeCircularly permutated firefly luciferase with SbMV cleavage site (Luciferase reporter for detection of proteolytic activity)DepositorInsertcyclic luciferase with SbMVp cleavage site
UseLuciferaseTagsAU1 tagExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
KP301: pMVP (L5-L4) mCherry-P2A
Plasmid#121710PurposepMVP L5-L4 entry plasmid, contains mCherry-P2A for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term mCherry linked by P2A to gene of interest.DepositorInsertmCherry-P2A (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_NANOG
Plasmid#64153PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA1_NANOG (NANOG Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLN397 (FuGW-S(E2F1)p-Sponge7)
Plasmid#105181PurposeModule 2 - synthetic promoter E2F1 drives sponge 7 ,"optimized sponge" expression. (see PMID: 29056342 for detailed information)DepositorInsertS(E2F1)p-Sponge7
UseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AktPH-mCherry-T2A-PHR-T2A-CIBNcaax
Plasmid#173861PurposeMammalian expression of Akt PH-mCherry-T2A-PHR-T2A-CIBNcaax (PIP3 marker and opto-control)DepositorInsertAktPH-mCherry-T2A-PHR-T2A-CIBNcaax
UseTagsC-terminal CAAX-box and mCherryExpressionMammalianMutationPromoterCAGAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-MCS-QF-MiniWhite
Plasmid#165906PurposeBlasticidin resistant QF driver vector with Mini-white CDS eye marker. Contains an enhancer grammar GB20 entry point for custom enhancers. Standard cut-and-paste cloning can also be used. Vector uses Purple-White bacteria colony screening for identification of correct cloningDepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSETb-pcDronpa2-A69T
Plasmid#98578Purposephotoconvertible fluorescent protein pcDronpa2-A69T in pRSetB plasmid, photoconvertible by primed conversion mechanism, bacterial overexpressionDepositorInsertpcDronpa2-A69T
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceMarch 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAT15542_nCBE-SuperFi-Cas9
Plasmid#184372PurposeMammalian expression of SuperFi-Cas9 CBE base editorDepositorInsertnCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q10…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15544_nABE-SuperFi-Cas9
Plasmid#184374PurposeMammalian expression of SuperFi-Cas9 ABE7 base editorDepositorInsertnABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q10…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF (VE5596)
Plasmid#139768PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette.DepositorTypeEmpty backboneUseTagsExpressionMutationPromoterPH or p10Available sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSETa-mKikGR-V69T
Plasmid#98574Purposephotoconvertible fluorescent protein mKikGR-V69T in pRSetA plasmid, photoconvertible by primed conversion mechanism, bacterial overexpression, sequence is codon optimised for E. coliDepositorInsertmKikGR-V69T
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceMarch 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NI_G1397-DddtoxA-C
Plasmid#171726PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorTagsExpressionMutationPromoterAvailable sinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NG_G1397-DddtoxA-C
Plasmid#171734PurposeptpTALECD vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorTagsExpressionMutationPromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NG_G1397-DddtoxA-N
Plasmid#171735PurposeptpTALECD vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorTagsExpressionMutationPromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NI_G1397-DddtoxA-N
Plasmid#171727PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorTagsExpressionMutationPromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NN_G1397-DddtoxA-N
Plasmid#171731PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorTagsExpressionMutationPromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NN_G1397-DddtoxA-C
Plasmid#171730PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorTagsExpressionMutationPromoterAvailable sinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
binder/tag-WT-FAK-insertionA
Plasmid#190439PurposeThe tag is SsrA (AANDENY). Tag is inserted after R35 of FAK.DepositorInsertFAK (Ptk2 Mouse)
UseTagsmCherryExpressionMammalianMutationSsrA inserted after aa 35PromoterAvailable sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRa34_1384
Plasmid#49693DepositorInsertECF34_1384
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable sinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT2Apuro-TRE-synPCB2.0
Plasmid#139481PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Fnr-Fd-T7
UseTol2 transposon donor vectorTagsExpressionMammalianMutationPromoterTet responsive elementAvailable sinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLN410 (FuGW-S(E2F1)p-ECFP sponge control)
Plasmid#105182PurposeModule 2 control - synthetic promoter E2F1 drives ECFP only (no miR1 binding sites)DepositorInsertS(E2F1)p-ECFP (Cerulean) sponge control
UseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
C. difficile toxin B mRNA toehold switch sensor
Plasmid#110715PurposeToehold switch sensor to detect the tcdB mRNA from toxigenic C. difficile with GFP outputDepositorInsertC. difficile toxin B toehold switch sensor
UseSynthetic BiologyTagsExpressionMutationPromoterT7Available sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only