We narrowed to 8,824 results for: AMPH
-
Plasmid#89374PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertIrf2bpl (Irf2bpl Mouse)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl I
Plasmid#89378PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertIrf2bpl (Irf2bpl Mouse)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl H
Plasmid#89377PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertIrf2bpl (Irf2bpl Mouse)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-n
Plasmid#53077Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-n
Plasmid#53065Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-er-n
Plasmid#53067Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-tgn-n
Plasmid#53071Purposedestination vector with ECFP-trans golgi network marker (VTI12) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-gateway
Plasmid#51070Purposegateway adapted mammalian expression vectorDepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterSV40Available SinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP
Plasmid#86457PurposeMouse stem cell retroviral vector including a puromycin resistance and BFP gene. sgRNA targets can be cloned in between the BbsI sitesDepositorInsertBFP
UseCRISPRExpressionMammalianPromoterPgkAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas-MmdCas12m-CBE1
Plasmid#192284PurposeMmdCas12m-CBE1 expressed under a constitutive promoterDepositorInsertMmdCas12m-CDA-UGI
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-PE3 HEK3
Plasmid#206273PurposeVector for the production of recombinant baculovirus using MultiMate assembly. All-in-one vector for PE3 HEK3 prime editing.DepositorInsertPE2 (synthetic), hU6 HEK3 PegRNA, hU6 HEK3 sgRNA, aeBlue (E. quadricolor), VSV-G, TagBFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-Hsp70-zCreI-mTagBFP2d-2xins (JDW 1002)
Plasmid#229817PurposeA gateway compatible Tol2 destination vector containing the Hsp70 promoter driving Cre and TagBFP followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB-Halo,IRES-NGFR
Plasmid#164520PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible NGFR and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiPromoter2x35SAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTon1(il11)
Plasmid#233647PurposeExpression vector of X. laevis il11.L-P2A-AcGFP1 under control of tetracycline responsive element (TRE). Also express Tet-on advenced transactivator (rtTA) under control of minimal CMV promoter.DepositorInsertsinterleukin-11.L (350-913) (il11.L Frog)
target sequence of guide RNA #tyr (3905-3927) 5'-GGCTCCATGTCTTCCGTCCAAGG-3'
UseAmphibian expression, tet-onMutationSome synonymous substitutions were introduced in…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV H2B iRFP
Plasmid#206253PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes H2B iRFP713 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertH2B iRFP713
UseRecombinant baculovirus production, multimate/gat…TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQZ210
Plasmid#106414PurposeCo-expresses trans SNARE complex with pDC183 in E.coliDepositorInsertsTagsHis tagExpressionBacterialMutationFragment 191-256 , Codon optimization and Fragmen…PromoterT7Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAVA-LGF2(fs)-Gal11p(fs)
Plasmid#127483PurposeNegative control for the AVA-seq system. LGF2 (with one nucleotide insertion) (lambda CI associated) and Gal11p (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertLGF2 (frame shift)-Gal11p (frame shift) (GAL11 Budding Yeast)
ExpressionBacterialMutationOne nucleotide inserted between lambda CI and LGF…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB013
Plasmid#119710PurposeTU of the HSVtk negative marker for F2dU domesticated into pUPD2 with GGAG/TACT barcodes (reverse orientation). Used for gene KO with dual selec. According to FungalBraid modular DNA assembly for ATMTDepositorInsertNegative selection marker HSVtk (Pgpda:HSVtk:Ttub)
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh1
Plasmid#132709PurposeEncodes short hairpin RNA (shRNA) #1 that targets the 3’-untranslated region of the rat Crh geneDepositorAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4800
Plasmid#249323PurposeTo express the EPEC DarT2(DLAA)-nScCas9(D10A) fusion protein in experiments for Append EditingDepositorInsertEPEC DarT2(DLAA)-nScCas9(D10A)
ExpressionBacterialMutationDarT2(G49D, M86L, R92A, R193A) and nScCas9(D10A)Available SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-6738
Plasmid#249322PurposeTo express the EPEC DarT2(G49D)-nScCas9(D10A) fusion protein in experiments for Append EditingDepositorInsertEPEC DarT2(G49D)-nScCas9(D10A)
ExpressionBacterialMutationDarT2(G49D) and nScCas9(D10A)Available SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBD-PYR1
Plasmid#241278PurposeYeast two hybrid vector expressing BD-PYR1 (wild type)DepositorAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA-2xIns-fli1ep-zCreI-BFP (JDW 1218)
Plasmid#229819PurposeA gateway compatible Tol2 destination vector containing the fli1a promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-hsp70-zCreI-BFP (JDW 1184)
Plasmid#229831PurposeA gateway compatible Tol2 destination vector containing the hsp70 promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNeonGreen-C1-Nir1-631-894
Plasmid#220089PurposeTruncated Nir1-LNS2 domain lacking N-terminal amphipathic helix; loses ability to bind PADepositorInsertPITPNM3 (PITPNM3 Human)
TagsNeonGreen-GGSGGExpressionMammalianMutationamino acids 631-894PromoterCMVAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot1iso1_1833-2361-F2353D_W
Plasmid#147883PurposeBacterial Expression of HsNot1iso1_1833-2361-F2353DDepositorInsertHsNot1iso1_1833-2361-F2353D (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot1iso1_1833-2361-I2330E_W
Plasmid#147884PurposeBacterial Expression of HsNot1iso1_1833-2361-I2330EDepositorInsertHsNot1iso1_1833-2361-I2330E (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS10-riboE-dddAI
Plasmid#186561PurposeRegulated expression of the DddA immunity determinant (DddAI) in FirmicutesDepositorInsertdddAI
ExpressionBacterialPromoterpSpac(hy)Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA:scaffold tetraloop MS2 aptamer SAM (GB1436)
Plasmid#160570PurposeA version of scaffold sgRNA with the sequence of MS2 aptamer inside the tetraloop of the scaffoldDepositorInsertsgRNA:scaffold tetraloop MS2 aptamer SAM
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh2
Plasmid#132710PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Crh geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pABD823
Plasmid#67911PurposeProtein interaction with yeast two hybrid assay of CTG10 in yeast, Saccharomyces cerevisiaeDepositorInsertCold temperature germinating 10 (CTG10)
TagsGAL4 DNA binding domain (148 amino acids)ExpressionYeastPromoterpADH1 (alcohol dehydrogenase 1 promoter)Available SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl C
Plasmid#89372PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl B
Plasmid#89371PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl D
Plasmid#89373PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl A
Plasmid#89370PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
ExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBFC0984
Plasmid#231992PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with 2xBsaI spacer cloning siteDepositorInsertsdRfxCas13d
crRNA with 2xBsaI spacer
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and pTetAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBFC0993
Plasmid#231993PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with negative control (RFP-targeting) spacerDepositorInsertsdRfxCas13d
crRNA with negative control (RFP-targeting) spacer
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and pTetAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N1
Plasmid#125547PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to n-terminus of Gatew…ExpressionBacterial and MammalianPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C1
Plasmid#125549PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only