-
Plasmid#166094PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRTagsExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 dCas9 (GB2664)
Plasmid#160596PurposeCDS of dCas9 with B3 nomenclatureDepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro
Plasmid#214680PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two empty sgRNA cloning sitesDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianMutationPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Wheat_live_Cas9
Plasmid#126880PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and BpiI sites for sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-VP64-dCas9-VP64-ZsG
Plasmid#192668PurposeDox-inducible expression of VP64-dCas9-VP64 with 2A ZsGreen1DepositorInsertVP64-dCas9-VP64, ZsGreen1
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A and N863A in Cas9PromoterTRE3GAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti-RfxCas13d-Blast-BFP
Plasmid#196726PurposeSortable and selectable RfxCas13d.DepositorInsertRfxCas13d-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsSV40 NLSExpressionMutationPromoterEF1aAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti.Cas9.BFP.Blast
Plasmid#196714PurposeWT SpCas9 with BSD-TagBFP for selection and sortingDepositorInsertCas9-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterEF1aAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-T2A-Puro
Plasmid#101039PurposeEnhanced SpCas9(1.1) with puromycin resistance gene via T2A linker.DepositorTypeEmpty backboneUseCRISPRTags3xFLAG and T2A-PuroExpressionMammalianMutationPromoterCBhAvailable sinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9
Plasmid#107031PurposeAAV plasmid expressing Cas9 under control of miniCMV promoterDepositorInsertSpCas9
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-KRAB_Hygro
Plasmid#192663Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A Hygro resistance markerDepositorInsertdCas9-KRAB
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A, D839A, H840A and N863A in Cas9PromoterEF1aAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-dCas9-VPR-wpA-pPuroTK
Plasmid#214127PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertdCas9-VPR
UseCRISPRTagsExpressionMammalianMutationCodon-optimized for mammalian cellsPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-AsCpf1
Plasmid#107034PurposeAAV plasmid expressing AsCpf1 under control of miniCMV promoterDepositorInsertAsCpf1
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROPSeq-PP7-p65-HSF
Plasmid#196719PurposeCROP-Seq library plasmid for CRISPR-A with SAM system (p65-HSF1 activator recruited to PP7 binding loops in the tracrRNA of the guide).DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pX551-CMV-CjCas9
Plasmid#107035PurposeAAV plasmid expressing CjCas9 under control of CMV promoterDepositorInsertCjCas9
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pnos-Fok1:dCas9-nos
Plasmid#62210PurposeExpresses Fok1:dCas9 under control of nanos promoter and 3'UTR. For germ line restricted high specificity genome engineering in Drosophila melanogaster.DepositorInsertFok1-dCas9
UseTagsExpressionInsectMutationPromoternanosAvailable sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pB-CAG-PE2-NatMX
Plasmid#158567PurposePiggybac vector that allows for the generation of PE2-expressing stable cell linesDepositorInsertPE2
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-CjCas9
Plasmid#107033PurposeAAV plasmid expressing CjCas9 under control of miniCMV promoterDepositorInsertCjCas9
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SaCas9
Plasmid#107032PurposeAAV plasmid expressing SaCas9 under control of miniCMV promoterDepositorInsertSaCas9
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-pegRNA-tetra-com vector
Plasmid#136271PurposeExpresses PE2 and Tetra-com modified pegRNA cassetteDepositorInsertPE2 and pegRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-pegRNA-ST2-com-vector
Plasmid#136272PurposeExpresses PE2 and ST2-com modified pegRNA cassetteDepositorInsertPE2, pegRNA scaffold
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1328
Plasmid#69488PurposesgRNA(F+E) targeting pha-1 (no Cas9); for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
UseTagsExpressionWormMutationPromoterR07E5.16 U6 promoterAvailable sinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 5' Npm1 gRNA
Plasmid#127900PurposeWT Cas9 Vector targeting the 5' end of the mouse Npm1 geneDepositorInsertgRNA/Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
A5TSR
Plasmid#50358Purposeexpresses T.gondii MIC2(67-593) domains in mammalian cellsDepositorInsertMIC2-A5TSR
UseTagsHISExpressionMammalianMutationS158A, N357S, N463S, N470DPromoterCHICK beta-actin promoterAvailable sinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Dpi2Cas9-puro
Plasmid#232113PurposeExpresses Dpi2Cas9 and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Slu1Cas9-puro
Plasmid#232111PurposeExpresses Slu1Cas9 and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Slu2Cas9-puro
Plasmid#232112PurposeExpresses Slu2Cas9 and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SeqCas9-puro
Plasmid#232110PurposeExpresses SeqCas9 and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianMutationPromoterU6 promoterAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR Ef1a-dCas9-BFP-KRAB
Plasmid#217304Purposelentiviral vector for dCas9-BFP-KRAB on Ef1alpha promoterDepositorInsertdCas9-tagBFP-KRAB
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMutationPromoterEf1alphaAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Blast_HP1beta_gRNA
Plasmid#127908PurposeWT Cas9 Vector with Blasticidin Selection Marker targeting the 5' end of the human HP1beta geneDepositorInsertgRNA for Human 5' HP1beta
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ CUL3
Plasmid#126891PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ PLDbeta1
Plasmid#126890PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ WRKY28_1
Plasmid#126887PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ HDT701
Plasmid#126886PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac5
Plasmid#126885PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac4
Plasmid#126884PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Rac4
Plasmid#126896PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ CUL3
Plasmid#126903PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_Rac5
Plasmid#126897PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_1
Plasmid#126899PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_2
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only