We narrowed to 410 results for: Superfolder GFP
-
Plasmid#218953PurposeExpresses proinsulin fused to mGold in bacteriaDepositorInsertproinsulin-mGold
TagsproinsulinExpressionBacterialPromoterT5Available SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE81XN-msYFP2
Plasmid#218961PurposeExpresses Hisx6-Tagged msYFP2 in bacteriaDepositorInsertmsYFP2
Tags6X-HisExpressionBacterialPromoterT5Available SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
proinsulin-msYFP2
Plasmid#218955PurposeExpresses proinsulin fused to msYFP2 in bacteriaDepositorInsertproinsulin-msYFP2
TagsproinsulinExpressionBacterialPromoterT5Available SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE81XN-EYFP
Plasmid#218958PurposeExpresses Hisx6-Tagged EYFP in bacteriaDepositorInsertEYFP
Tags6X-HisExpressionBacterialPromoterT5Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
MFVN-msYFP
Plasmid#218971PurposeExpresses the first 4 aa of proinsulin fused to msYFP in bacteriaDepositorInsertMFVN-msYFP
TagsmsYFPExpressionBacterialAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB_tetO7_sfGFP
Plasmid#196616PurposePlasmid for integrating tetO7-controlled sfGFP into the HO region in yeastDepositorInsertSuperfolder GFP
ExpressionYeastPromotertetO7 promoterAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbR-HIS-sfGFP-DocI
Plasmid#58708PurposeCharacteristic fingerprint molecule to perform single molecule force spectroscopy experiments; covalently immobilized via ybbr tagDepositorInsertsfGFP-DocI
TagsHIS, HRV 3C, and ybbRExpressionBacterialPromoterT7Available SinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[N150TAA]
Plasmid#164581Purposesuperfolder GFP with N150TAA mutationDepositorInsertsfGFP-150TAA
Tags6xHisExpressionBacterialMutationN150TAA MutationPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-DQNAT
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
prCAG-RBS"m1"-sfGFP
Plasmid#191400PurposeExpression of 47 rCAG repeats fused to a translational unit over-expressing superfolder GFP using a strong RBS. The RBS contains mutation (m1)DepositorInsert47xCAG RBS"m1"-sfGFP
UseSynthetic BiologyExpressionBacterialPromoterPLtet0-1Available SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIBA3-SpyCatcherEQ-sfGFP
Plasmid#107421PurposeFor production of inactive SpyCatcherEQ protein fused N-terminally to sfGFP. Includes N-terminal His tag for purification and C-terminal StrepII tag for detection.DepositorInsertSpyCatcher
TagsHis tag, StrepII, and superfolder GFPExpressionBacterialMutationmutation of glutamate 77 to glutaminePromoterTetAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MFVN-mStayGold(J)
Plasmid#225444PurposeExpresses mStayGold(J) fused to the first 4 amino acids of proinsulinDepositorInsertMFVN-mStayGold(J)
ExpressionBacterialAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE81XN-mStayGold(J)
Plasmid#225445PurposeExpresses Hisx6-Tagged mStayGold(J) in bacteriaDepositorInsertmStayGold(J)
Tags6X-HisExpressionBacterialAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-msfGFP
Plasmid#194913PurposeTetracycline inducible expression of msfGFP in StaphylococciDepositorInsertShine Dalgarno Sequence followed by monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_ReBphP-PCM_IRES_sfGFP
Plasmid#166917PurposeExpress ReBphP-PCM and sfGFPDepositorInsertsReBphP-PCM
sfGFP
ExpressionMammalianPromoterCMVAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop A
Plasmid#171779PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-DogTag Loop A
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Val2…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[D134TAG+N150TAA]
Plasmid#164582Purposesuperfolder GFP with D134TAG and N150TAA mutationsDepositorInsertsfGFP-134TAG+150TAA
Tags6xHisExpressionBacterialMutationD134TAG + N150TAA MutationsPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop A
Plasmid#171776PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-SpyTag003 Loop A
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues V…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop C
Plasmid#171781PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-DogTag Loop C
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop B
Plasmid#171777PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-SpyTag003 Loop B
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop C
Plasmid#171778PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-SpyTag003 Loop C
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-AQNAT
Plasmid#198211PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing a non-permissible AQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_AQNAT
Tags6x His Tag and AQNAT mutated (non-permissible) gl…ExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-MOOR
Plasmid#198212PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 32 amino acids containing the minimum optimal O-linked recognition site (MOOR) followed by a 6x-His tagDepositorInsertsfGFP_MOOR
Tags6x His Tag and MOOR glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-MOORmut
Plasmid#198213PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 32 amino acids containing a non-permissible minimum optimal O-linked recognition site (MOORmut) followed by a 6x-His tagDepositorInsertsfGFP_MOORmut
Tags6x His Tag and mutated (non-permissible) MOORmut …ExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cx26-msfGFP
Plasmid#69016PurposeExpresses rat Cx26 (Gjb2 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cx30-msfGFP
Plasmid#69019PurposeExpresses human Cx30 (GJB6 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-sec:msfGFP
Plasmid#194914PurposeTetracycline inducible expression of msfGFP fused to Sec signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cx43K258stop-msfGFP
Plasmid#69023PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with msfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
TagsV206K monomerized super folder GFPExpressionMammalianMutationdelete codons 258-381 and fuse in frame to monome…PromoterCMVAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
psfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164477PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry.DepositorAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
TagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianPromoterChicken beta actin and Chicken beta actin (shared…Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
BAS286 C terminal SF-GFP hygBR
Plasmid#74081PurposeS.pombe recoded superfolder GFP in universal C-terminal tagging plasmid, hygB resistancDepositorInsertsuper-folder GFP
Available SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5079_pHR_PGK_sfGFP_CoV-F1
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUS252
Plasmid#127674PurposeExpresses fuGFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFP to place in other plasmid backbonesDepositorInsertFree Use GFP (fuGFP)
ExpressionBacterialPromoterlacAvailable SinceJune 24, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti sfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164478PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry. Plasmid for lentivirus production.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsmCherry and superfolder GFPExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR_sfGFP-TurboID
Plasmid#240226PurposeGateway entry clone with TurboID tagged with superfolder GFP (contains stop codon)DepositorInsertsfGFP-TurboID
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-mEYFP
Plasmid#218968PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mEYFPDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pminiTol2-5xUAS-sfGFP-zP2A-zB19G-zT2A-zTVA (UGBT)
Plasmid#240274PurposeHelper plasmid for zebrafish rabies virus based-circuit tracingDepositorArticleInsertsB19G (codon-optimized for Danio rerio)
sfGFP (codon-optimized for Danio rerio)
TVA (codon-optimized for Danio rerio)
UseZebrafish expressionAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-sfGFP*-XcP4H-MH4R
Plasmid#178043PurposeExpress green fluorescent protein with TAG at 151 position and enzymes to biosynthesize 5HTPDepositorInsertssuperfolder green fluorescent protein with TAG at 151 position
XcP4H with W179F mutation
dihydropterine reductase from human
pterin-4a-carbinolamine dehydratase from human
TagsHis tagExpressionBacterialAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
TfR-sfGFP-myc tag-SpyCatcher003
Plasmid#133451PurposeExpresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detectionDepositorInsertTfR-sfGFP-myc tag-SpyCatcher003
TagsGSSGS and myc tagExpressionMammalianMutationContains C20 and A23 mutations that improve plasm…PromoterCMVAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-td-sfGFP-FNF-TK
Plasmid#134321PurposeB6J Cdk6-T2A-td-sfGFP allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse TargetingTagsC-terminal fusion of T2A-tandem dimer-superfolder…Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUS252y
Plasmid#191834PurposeExpresses fuYFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuYFP to place in other plasmid backbones.DepositorInsertfuYFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252L
Plasmid#191832PurposeExpresses fuBFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuBFP to place in other plasmid backbonesDepositorInsertfuBFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits