We narrowed to 31,590 results for: REP
-
Plasmid#53706PurposeLuciferase reporter assay for CIP2A with point mutation on miR-375 binding siteDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on miR-375 binding site A (refer to cita…Available SinceJune 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
Plasmid#83841PurposeFluorescent probe for G1/S transition and M/G1 transition, one of two plasmids for the FUCCI4 cell cycle reporterDepositorUseLentiviralExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-spikeRBD::∆ACE2 SURF
Plasmid#206957PurposeFluorescent reporter of the interaction between SARS-CoV-2 spike and human ACE2DepositorTagscSURF, mCherry, and nSURFExpressionMammalianMutation17-615 and RBD (319-541)PromoterCMVAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EmGFP-LATS2/1 KD
Plasmid#52085PurposeLentiviral RNAi vector for knockdown of LATS2 and LATS1. Co-expresses EmGFP as reporterDepositorAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-KMS
Plasmid#188038PurposePolycistronic human KLF4, MYC and SOX2 were cloned into the pMXs vectorDepositorUseRetroviralExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d
Plasmid#183516PurposeMammalian cell expression of SARS-CoV-2 Spike protein S-GSAS-rS2d with (682-685) furin side replaced with GSAS and mutation S383C, D985CDepositorInsertrS2d (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-stop-mut-miR-375-mutA-E
Plasmid#53714PurposeLuciferase reporter assay for CIP2A with mutated firefly stop codon that also has five miR-375 binding site mutationsDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on the stop codon of firefly luciferase …Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Dynein-2_complex
Plasmid#132536PurposeFull length human (Hs) IFT dynein (dynein-2) complex for Sf9 expression. Contains His-ZZ-TEV-SNAPf-HC, WDR60, WDR34-Strep, LIC3, TCTEX-1, TCTEX1D2, LC8-1, LC8-2, TCTEX-3, Rbl-1, Rbl-2, LC8-like.DepositorInsertsTags8x His, Linker-TEV-linker-TEV, SNAPf, Strep, and …ExpressionInsectMutationCodon optimised for Sf9 expressionAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUW-OSKM
Plasmid#20328PurposeLentiviral plasmid expressing mouse Oct4, Sox2, Klf4 and cMyc for iPS cell generationDepositorUseLentiviralExpressionMammalianAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-OSKM
Plasmid#20321PurposeLentiviral plasmid for tet-inducible expression of mouse Oct4, Sox2, Klf4 and Myc for iPS cell generationDepositorAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d-HexaPro
Plasmid#183515PurposeMammalian cell expression of SARS-CoV-2 Spike protein rS2d-HexaPro with (682-685) furin side replaced with GSAS and mutation S383C, D985C, F817P, A892P, A899P, A942P, K986P,V987PDepositorInsertSpike (S-GSAS-rS2d.HexaPro) (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only