167,150 results
-
-
pCI SMN1
Plasmid#72286PurposeSMN1 exon 7 splicing cassetteDepositorAvailable SinceJan. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hIBA1a-GFP-miR124T
Plasmid#214147PurposeAAV vector to restrict GFP expression in microglia.DepositorHas ServiceAAV5InsertGFP
UseAAVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-GFP
Plasmid#84040PurposeStaphylococcus aureus (SaCas9) conjugated with GFPDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-EGFPExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-DIO-mNeonGreen-WPRE
Plasmid#223669PurposeCre-dependently expresses mNeonGreen in astorocytesDepositorInsertmNeonGreen
UseAAV and Cre/LoxPromoterGfaABC1DAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-F-RAM-d2tTA-TRE-mKate2
Plasmid#140274PurposeF-RAM, the Fos-dependent reporterDepositorInsertmKate2
UseAAVPromoterTREAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
GAL4BD-VP16/pDON207
Plasmid#201230PurposeGAL4-VP16 transcription factorDepositorInsertGAL4BD-VP16
ExpressionPlantAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCF159_BRL
Plasmid#225962PurposeCMV-Intron-BRL (env protein). Expresses BRL (BaEVRLess) env for VLP production.DepositorInsertCMV-Intron-BRL (env protein)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCBL101-RUBY
Plasmid#199723PurposeExpresses betalain biosynthesis genes under CaMV 35S promoterDepositorInsert35S-RUBY
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6c
Plasmid#207853PurposeMammalian expression of PE6c prime editorDepositorInsertPE6c
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_g5-HT3.0
Plasmid#208711PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0 in mammalian cellsDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV R-CEPIA1er
Plasmid#58216PurposeRed fluorescent indicator for calcium signaling in the endoplasmic reticulumDepositorInsertR-CEPIA1er
TagsmycExpressionMammalianMutationR-GECO1 E300D M305L D329N F332I E336D N346K F361W…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
35S-VP16-GWY/pAM
Plasmid#201234PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-VP16-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GAL4BD-GWY/pAM
Plasmid#201233PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GAL4BD-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-GAL4BD/pAM
Plasmid#201231PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GWY-GAL4BD
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
phCMV-GALV-MTR
Plasmid#163612PurposeRetro and Lentiviral transduction of primary human germinal center B cellsDepositorInsertGaLV MTR envelope
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-VP16/pAM
Plasmid#201232PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-GWY-VP16
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS2
Plasmid#46954PurposeCloning plasmid for the generation of Knock-In in human cells using rAAV.DepositorTypeEmpty backboneUseAAVAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmax
Plasmid#174820PurposeMammalian expression of SpCas9 PEmax prime editorDepositorInsertPEmax
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP
Plasmid#37825PurposeAAV-mediated expression of GFP under the CAG promoterDepositorHas ServiceAAV CAP-B10, AAV CAP-B22, AAV MaCPNS1, AAV MaCPNS2, AAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV6, AAV6 trial size, AAV8, AAV8 trial size, AAV9, AAV9 trial size, and AAV9-X1.1InsertGFP
UseAAV; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
Ub-G76V-GFP
Plasmid#11941DepositorInsertUb-G76V-GFP
ExpressionMammalianMutationUbiquitin fused to N-terminus of GFP. Glycine 76 …Available SinceJune 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9
Plasmid#42230PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
c-myc-PT3EF1a
Plasmid#92046PurposeExpresses c-Myc in mammalian cellsDepositorAvailable SinceJuly 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF1106
Plasmid#143762PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-bacteria
Plasmid#44249PurposeaTc-inducible expression of a catalytically inactive bacterial Cas9 (S. pyogenes) for bacterial gene knockdownDepositorInsertdCas9 (bacteria)
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)PromoterpLtetO-1Available SinceApril 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mito).cpSFGFP.HaloTag
Plasmid#214925PurposeExpresses mitochondrially targeted non-responsive controlDepositorInsert(mito).cpSFGFP.HaloTag
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GNSTM-3-RVG-10-Lamp2b-HA
Plasmid#71294PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsGNSTM glycosylation motif, HA, Lamp2 signal pepti…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only
