We narrowed to 33,749 results for: IND
-
Plasmid#180817PurposeExpression of human PD-1 with immunoreceptor tyrosine-based inhibitory motif (ITIM) from BTLA, fused to mEGFPDepositorInsertPD-1 (BTLA ITIM) (PDCD1 Human)
UseLentiviralTagsmEGFPMutationreplaced PD-1-ITIM (VDYGEL) with BTLA-ITIM (IVYAS…PromoterSFFVAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
NmMetQ C20A
Plasmid#172112PurposeExpression of Methionine Binding Protein (MetQ) with C20A mutation in signal sequenceDepositorInsertMethionine Binding Protein
Tags10x Histidine Tag and N.meningitidis signal seque…ExpressionBacterialMutationChanged Proline 22 to Alanine on MetQ and Cystein…PromoterT7 PromoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700]-Ss(424)
Plasmid#166852PurposeExpresses 6xHis tagged ATG13 [571–700] fragment with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeast.DepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-GFP
Plasmid#166840PurposeExpresses ER localized Vac8-GFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsGFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-10xMS2 no wild type
Plasmid#158204PurposeCassette of 10 different binding sites with high affinity to MS2 phage coat protein, as extracted form the oligo pool experiment. It does not contain the MS2-wt sequence, therefore QCP cannot bind it.DepositorInsert10 binding sites of MS2 without the WT sequence from oligo library experiment
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-10xQb no wild type
Plasmid#158205PurposeCassette of 10 different binding sites with high affinity to Qb phage coat protein, as extracted form the oligo pool experiment. It does not contain the Qb-wt sequence, therefore MCP cannot bind it.DepositorInsert10 binding sites of QB coat protein without the WT sequence based on the oligo library experiment
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-RNF169UBD
Plasmid#119009PurposeMammalian expression of a fusion protein of human BRCA1 with the human RNF169 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-Rad18UBD
Plasmid#119008PurposeMammalian expression of a fusion protein of human BRCA1 with human Rad18 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQLink-GST-2xCTD
Plasmid#138470PurposeExpresses GST-tagged 2xCTD heptapeptide repeat in bacteriaDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLB(N)CX-FLAG-CH3 Del33
Plasmid#133724PurposeRetroviral vector with CMV promoter driving mutant form of CH3 domain fragment of human p300 (EP300), with N-terminal FLAG tag.DepositorInsertEP300 (EP300 Human)
UseRetroviralTagsFlagMutationpartial (not complete) p300 fragment, AT and CH3 …PromoterCMVAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-Sox2TALE-GCN4
Plasmid#120548PurposeExpress 3xNLS-Sox2 TALE-GCN4 engineered to bind a site in the human SOX2 geneDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-NGN2TALE-GCN4
Plasmid#120547PurposeExpress 3xNLS-NGN2 TALE-GCN4 engineered to bind a site in the human NGN2 eneDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVL43 - pNST3>>
Plasmid#116009Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpNST3:GR-LhG4:tNST3:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVL42 - pLTP1>>
Plasmid#116008Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpLTP1:GR-LhG4:tLT1:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-puro-eGFP-HEC1-M4
Plasmid#114036PurposeExpression of HEC1 M4 mutant tagged with GFPDepositorInsertGFP tagged - HEC1 -M4 (NDC80 Human)
ExpressionMammalianMutationM4 (K146E, R153E, K156E)PromoterCMV TetOAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-puro-eGFP-HEC1-M2
Plasmid#114035PurposeExpression of HEC1 M2 mutant tagged with GFPDepositorInsertGFP tagged - HEC1 -M2 (NDC80 Human)
ExpressionMammalianMutationM2 (K81E, N87E, K89E)PromoterCMV TetOAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q48A)
Plasmid#112724PurposeGln48 contacts the backbone of TAR RNA as well as mediates intramoecular interaction to stabilize the conformation of beta2-beta3 loop within TBP6.7.DepositorInsert6His-TEV-TBP6.7(Q48A)
Tags6His-TEVExpressionBacterialMutationQ48APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R52A)
Plasmid#112729Purpose52nd position is Arg in both wild-type U1A and TBPs, but the RNA recognition by this residue in both types of proteins is fundamentally different.DepositorInsert6His-TEV-TBP6.7(R52A)
Tags6His-TEVExpressionBacterialMutationR52APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(delta C-term)
Plasmid#112731PurposeThis mutant of TBP6.7 is lacking residues 91-98 at C-terminus, and was used to test the involvement of those residues in TAR recognition.DepositorInsert6His-TEV-TBP6.7(delta C-term)
Tags6His-TEVExpressionBacterialMutationdelta C-termPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_LKB1_CR
Plasmid#108112PurposeLentiviral expression plasmid of human LKB1 cDNA (CRISPR-resistant silent mutation) with neomycin resistance geneDepositorInsertLKB1 (STK11 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchange cytosine 333 to alanine (silent mutation)PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PatoM-OG241
Plasmid#72842PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. OG241 backbone.DepositorInsertPatoM
ExpressionBacterialPromoterPatoMAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETDUET1-hUCH37 (ISF1) - hNFRKB (1-156) GSGS
Plasmid#61940PurposeCo-expression of hUCH37 (ISF1) and hNFRKB (1-156) GSGS in E.coliDepositorTags6x HISExpressionBacterialMutationConstruct ends at residue 156, residues 97-100 (N…PromoterT7Available SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETDUET1-hUCH37 (ISF1) - hNFRKB (1-117)
Plasmid#61941PurposeCo-expression of hUCH37 (ISF1) and hNFRKB (1-117) in E.coliDepositorTags6x HISExpressionBacterialMutationConstruct ends at residue 117, stop codon introdu…PromoterT7Available SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
GalT-RpHLuorin2
Plasmid#171719PurposeTrans-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to B4GALT1 (B4GALT1 Human)
Tagsratiometric pHluorin2ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7
Plasmid#136466PurposeMammalian expression of non-targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF1alpha P402A/P564A-pcDNA3
Plasmid#18955DepositorInsertHypoxia inducible factor 1 alpha (HIF1A Human)
TagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 402 to Alanin…Available SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2alpha-P405A/P531A-pcDNA3
Plasmid#18956DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
TagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
MGAT2-RpHLuorin2
Plasmid#171718PurposeCis-/medial-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to MGAT2 (MGAT2 Human)
Tagsratiometric pHluorin2ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-WPRE
Plasmid#225709PurposePan-neuronal, pan-membrane expression of the genetically encoded voltage indicator ASAP5; can be used for dendritic voltage imagingDepositorInsertASAP5
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_T221E
Plasmid#108108PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & TE mutation at LKB1 phosphorylation site) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-R-GECO1
Plasmid#46021PurposeRed intensiometric genetically encoded Ca2+-indicators for optical imagingDepositorInsertR-GECO1
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
mCherry-eDHFR-Cdc42Q61L
Plasmid#107267PurposemCherry-eDHFR-Cdc42Q61L in pIVT vector for in vitro transcription. Note that Cdc42 in this plasmid keeps its CAAX domain.DepositorAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
ET8-GPIba-6His
Plasmid#102878PurposeWild type human platelet membrane protein GPIb alpha (1-290aa) with 6Histag at the C-terminusDepositorInsertHuman platelet membrane protein GPIb alpha 1-290aa (GP1BA Human)
Tags6xHis tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-Kv2.1-WPRE
Plasmid#225707PurposePan-neuronal soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV1InsertASAP5-Kv2.1
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-Gata2
Plasmid#193087Purposeconstitutive expression of mouse Gata2 in mammalian cellsDepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
Plasmid#212829PurposeDoxycycline-inducible (Zim3)KRAB-dCas9-HA-P2A-mCherry cassette for integration at the AAVS1-locus of the human genome.DepositorInsertZIM3-KRAB-dCas9-P2A-mCherry
TagsHA-tag and ZIM3-KRABExpressionBacterial and MammalianPromoterCAG, TetOnAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE
Plasmid#225708PurposeCre dependent soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV9InsertASAP5-Kv2.1
UseAAVPromoterEF1αAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-Casp3-TEV
Plasmid#183766PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The Caspase3 expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene - tetO promoter-flex/DIO-Caspase3-TEV
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromotertetO promoterAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
iCas
Plasmid#84232PurposeExpression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT)DepositorInsertCas9
Tags2A-OFP co-expression and ERT2-ERT2ExpressionMammalianPromoterCMVAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFUW-tetO- FOS
Plasmid#125598Purposedoxycycline-inducible expression of human FOS in mammalian cellsDepositorInsertFos proto-oncogene, AP-1 transcription factor subunit (FOS Human)
UseLentiviralExpressionMammalianPromoterTRE-mCMVAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-HA-mScarlet3-tdP2A-Frankenbody-FLAG-mEGFP-IRESv4-HaloTag-tdMCP
Plasmid#241140PurposeExpresses Anti-HA frankenbody-mScarlet3, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent HA and FLAG-tagged proteins and MS2-tagged mRNAand MS2-tagged mRNADepositorInsertsAnti-FLAG frankenbody
anti-FLAG frankenbody
tdMCP
TagsHaloTag, mEGFP, and mScarlet3ExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLifeAct-HyPer7
Plasmid#136464PurposeMammalian expression of F-actin targeted ultrasensitive hydrogen peroxide indicator HyPer7 fused with LifeAct peptide for optical imagingDepositorInsertHyPer7
TagsLifeActExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-osTIR1
Plasmid#207840PurposeInducible TIR1 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsosTIR
mCherry
mAID_-VHH-GFP4
Tags3X HA-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_control_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#183951PurposeInducible lentiviral expression, TRE-control-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTADepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFPZNF598-9P-9A
Plasmid#141192PurposeExpresses GFP-ZNF598 mutated in polyproline streches in mammalian cells, can be used to make inducible cell lineDepositorInsertZNF598 (ZNF598 Human)
TagsGFPExpressionMammalianMutationall 3 proline repeats are mutated to Alanine (9xP…PromoterCMVAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only