171,723 results
-
Plasmid#73687PurposePunc-47::2xNLS-FLP-D5 Expression vectorDepositorInsertPunc-47::2xNLS-FLP-D5::let-858 3'-UTR
UseFlp/frtExpressionWormPromoterPunc-47Available SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(EF1a no GFP) mnuctdTomato
Plasmid#172342PurposemnuctdTomatoDepositorInsertsmonomeric nuclear Tomato
HygR
UseLentiviral and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterEF1alphaAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
1XDR4
Plasmid#32614DepositorInsert1XDR4
ExpressionMammalianAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJK369
Plasmid#73594PurposeEncodes Crepis alpina delta-12 fatty acid acetylenase (vFAD2) with C-terminal FLAG epitopeDepositorInsertdelta-12 fatty acid acetylenase
TagsFLAG tagExpressionYeastPromoterGAL10Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-M2rtTA
Plasmid#60843PurposeAAVS1 donor vector for genomic targetingDepositorInsertsM2rtTA
Neo
UseTargeting donorAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-DIO-PinkyCaMP
Plasmid#232857PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under Syn promoter in a Cre-dependent manner (DIO, double floxed inverted open reading frame)DepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MA-VN
Plasmid#123283PurposeMammalian expression plasmid for matrix domain of HIV-1 Gag fused to the N-terminal half of split fluorescent Venus (VN)DepositorInsertMatrix
TagsVN: N-terminus of split Venus (a.a. V1–A154) I152…ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJT2
Plasmid#98306PurposeOverexpressing yeast farnesyl pyrophosphate synthase Erg20p mutant N127W and Actinidia chinensis nerolidol/linalool synhtase AcNES1 under the control of TEF1/TEF2 promoterDepositorInsertPTEF2>ScERG20N127W>TRPL3>PTEF1>AcNES1>TRPL41B
ExpressionYeastMutationERG20 N127WAvailable SinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
NES-mCherry-PH-BTKx2
Plasmid#183654PurposePtdIns(3,4,5)P3 biosensorDepositorInsertBTK (BTK Human, Frog)
TagsX. laevis map2k1.L(32-44)-mCherryExpressionMammalianMutationAmino acids 2-174 and 2-170PromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA1.332 pDUOTK1-L1
Plasmid#162351PurposeLevel 0 terminator acceptor containing dual fluorophores for testing transcription terminator efficiencyDepositorInsertseYFP
LacZ alpha
mTagBFP
UseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_CMV
Plasmid#99314PurposeLuciferase validation vector with CMV enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertCMV enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
GIPR-DuET
Plasmid#213252PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-g418-3HA::FRB::3HA
Plasmid#247588PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xHA
UseUnspecifiedPromoterread throughAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-pCALM1-Cre-3'-KIF1A-FLAG
Plasmid#244343Purpose3' AAVLINK plasmid for KIF1A expressionDepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28_WT-LGP2 (codon optimized)
Plasmid#248163PurposeExpresses full-length human LGP2 in E. coliDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINK-EFS-HA-5'-KIF1A
Plasmid#244342Purpose5' AAVLINK plasmid for KIF1A expressionDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rubicon
Plasmid#221659PurposeRubicon tagged N-terminally with EGFP; clone a gift from the Hurley Lab at UC BerkeleyDepositorAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Rubicon
Plasmid#221657PurposeRubicon tagged N-terminally with mCherryDepositorAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF myc-SHP2(WT)
Plasmid#245220PurposeMammalian expression of myc-tagged full-length SHP2DepositorInsertSHP2 full-length
TagsmycExpressionMammalianMutationwild-typeAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_5F66
Plasmid#234226PurposeHeterologous protein expression of peptidyl-prolyl cis-trans isomerase A (PPIase A) in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Bxb1-GT_TRE-mScarlet
Plasmid#229796PurposeBxb1-GT donor plasmid for doxycycline-inducible mScarlet expressionDepositorInsertmScarlet
UseSynthetic BiologyExpressionMammalianPromoterTREAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
HR700_HA2TP53_Ex5
Plasmid#228860PurposeBackbone for generation of donor vectors for CRISPR/Cas9 mediated Saturation Genome Editing (SGE) of TP53 Exon 5DepositorTypeEmpty backboneUseCRISPR and Cre/LoxExpressionMammalianAvailable SinceFeb. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HR700_HA2TP53_Ex6
Plasmid#228861PurposeBackbone for generation of donor vectors for CRISPR/Cas9 mediated Saturation Genome Editing (SGE) of TP53 Exon 6DepositorTypeEmpty backboneUseCRISPR and Cre/LoxExpressionMammalianAvailable SinceFeb. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HR700_HA2TP53_Ex7
Plasmid#228862PurposeBackbone for generation of donor vectors for CRISPR/Cas9 mediated Saturation Genome Editing (SGE) of TP53 Exon 7DepositorTypeEmpty backboneUseCRISPR and Cre/LoxExpressionMammalianAvailable SinceFeb. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HR700_HA2TP53_Ex8
Plasmid#228863PurposeBackbone for generation of donor vectors for CRISPR/Cas9 mediated Saturation Genome Editing (SGE) of TP53 Exon 8DepositorTypeEmpty backboneUseCRISPR and Cre/LoxExpressionMammalianAvailable SinceFeb. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
SFFV-ZFPM2-Brd 326
Plasmid#219256PurposeTranscription factor ZFPM2 with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-AUG-IRES-mCherry
Plasmid#222109PurposeStart codon reporter (WT AUG)DepositorInsertGFP-IRES-mCherry
UseLentiviralAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dox-SOScat
Plasmid#207329PurposePiggyBac vector backbone encoding doxycycline-inducible expression of membrane-localized catalytic domain of SOS (SOScat)DepositorInsertson of sevenless homolog 2 variant, catalytic domain
Tagsmyristoylation tag - BFPExpressionBacterialMutationrange: 593 to 1078PromoterTet Response ElementAvailable SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-g418-3Ty:mNG:3Ty
Plasmid#179800PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTSK573
Plasmid#190881PurposeFor C-terminal -Halo Tagging of a gene of interest with TRP1 selection marker in yeast S. cerevisiaeDepositorInsertHaloTag
UseBacterial cloning vectorAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pv6_CBX1_2xChromo-W42A
Plasmid#179394PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of CBX1_2xChromo(W42A)DepositorInsertCBX1_2xChromo(W42A)
TagsAviTag and EGFPExpressionMammalianMutationChromodomain W42APromoterCAGGSAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.NWS_mCherry-NLS
Plasmid#178282PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-BSD NFIL3 T2A Puro
Plasmid#140028PurposeTunable and temporal expression control of NFIL3 and puro resistant geneDepositorInsertNFIL3 (NFIL3 Human, Synthetic)
UseSynthetic BiologyTagspuromycinExpressionMammalianPromoterTRE3GAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-3XNeon-nls
Plasmid#75386PurposePCP-3XNeon-nlsDepositorInsertPCP
UseLentiviralTags3XmNeonGreenExpressionMammalianPromoterEFSAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-Bxb1-LP-v2-TC
Plasmid#194327PurposeCLYBL targeting construct with the Bxb1 landing pad version 2 cassette.DepositorInsertloxP-EBFP2-attP-BleoR-lox251
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Centrin2-N-10
Plasmid#55018PurposeLocalization: Centrosomes, Excitation: 587, Emission: 610DepositorAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-iGluSnFR.A184S (AAV5)
Viral Prep#106180-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.hSynap-FLEX.SF-iGluSnFR.A184S (#106180). In addition to the viral particles, you will also receive purified pAAV.hSynap-FLEX.SF-iGluSnFR.A184S plasmid DNA. Synapsin-driven, Cre-dependent expression of glutamate sensor iGluSnFR (high affinity). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Hsp90 HA
Plasmid#22487DepositorAvailable SinceMay 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLVET-IRES-GFP
Plasmid#107139PurposeA bicistronic lentiviral mammalian expression vector with a multiple cloning site and GFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Kif2A
Plasmid#52401PurposeExpresses GFP-tagged Kif2A in mammalian cells under the CMV promoterDepositorAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMVβ-p300-myc
Plasmid#30489PurposeMammalian expression of human p300 with myc tagDepositorAvailable SinceOct. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-DDX3X
Plasmid#116730PurposeLentiviral expression of DDX3XDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-TET1
Plasmid#83568PurposeExpresses TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM60 FLAG-RAB35 S22N
Plasmid#107106PurposeLentiviral vector that codes for FLAG-RAB35 S22N (human) protein. Puromycin resistance for mammalian selection and ampicillin resistance for growth in Stbl3 cells.DepositorAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRT006.3 L1 dual-luciferase AI retrotransposition reporter
Plasmid#213031PurposeBi-directional luciferase antisense intron (firefly fluc AI) human LINE-1 retrotransposition reporter (ORFeus-Hs sequence) for sleeping beauty integrationDepositorInsertTet-On Human LINE-1 (ORFeus-Hs) Firefly + Renilla Luciferase Antisense Intron dual retrotransposition marker
UseLuciferaseTagsFirefly luciferase antisense intron (3' UTR)ExpressionMammalianPromoterpTRE bidirectional tet-onAvailable SinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-EGFP (AAV1)
Viral Prep#50469-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CaMKIIa-EGFP (#50469). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-EGFP plasmid DNA. CamKIIa-driven EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsEGFPAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiCRISPRv2
Pooled Library#73632PurposeMouse sgRNA library in backbone lentiCRISPRv2 containing 78,637 unique sgRNAs targeting 19,674 genes along with 1000 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Cytb5
Plasmid#182579PurposeExpresses mCherry targeted to the ER via the CytB5RR tail anchor sequenceDepositorInsertmCherry-Cytb5
TagsCytb5ExpressionMammalianAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only