We narrowed to 23,159 results for: grna
-
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-spsgRNA2
Plasmid#64114PurposeVector for expression of Sp sgRNA2 in mammalian cellsDepositorInsertSp sgRNA2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLH-nmsgRNA1.1
Plasmid#64115PurposeVector for expression of Nm sgRNA1.1 in mammalian cellsDepositorInsertNm sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP
Plasmid#60955PurposeParental vector for the CRISPRi/a libraries. Expresses an sgRNA from the U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636
Plasmid#43860Purposeguide RNA (gRNA) expression vector used to create a gRNA to a specific sequence, uses U6 promoterDepositorInsertNone
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro
Plasmid#71236PurposeExpress sgRNA and dCas9-KRAB from lentiviral vectorDepositorInsertshumanized dCas9-KRAB T2A Puro
sgRNA
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro backbone
Plasmid#73795Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
PU6::unc-119_sgRNA
Plasmid#46169Purposeunc-119 targeting sgRNADepositorInsertunc-119 targeting sgRNA (unc-119 Synthetic)
UseCRISPRPromoterC. elegans U6 snRNA pol III promoterAvailable SinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2103
Plasmid#91061PurposeModule B, Promoter: CmYLCV, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterCmYLCVAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer
Plasmid#50920PurposeU6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sitesDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA_PDS
Plasmid#46966PurposeExpresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoterDepositorInsertAtU6p::sgRNA_PDS
UseCRISPR; Plant expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO-sgRNA-puro
Plasmid#104321Purpose3rd generation lentiviral plasmid for inducible expression of sgRNA; derived from tet-pLKO-puro; puromycin selection. See manual for detailed protocols.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterH1/TOAvailable SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas9 sgRNA vector
Plasmid#68463PurposeCas9 sgRNA vector for cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1651-sgRNA(F+E)-sgGal4
Plasmid#100549PurposesgGal4-expressing vector modified from Addgene plasmid #51024DepositorInsertsgGal4
UseCRISPRTagssgRNAExpressionMammalianPromoterU6Available SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.csr-1.Y-SUP4t
Plasmid#68060PurposegRNA for csr-1 locus in N. crassaDepositorInsertgRNA for csr-1 locus
UseCRISPR; N. crassa, fungiExpressionYeastPromoterSNR52Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP
Plasmid#71237PurposeExpress sgRNA and dCas9-KRAB from 3rd generation lentiviral vectorDepositorInsertshumanized dCas9-KRAB T2A GFP
sgRNA
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
U6.3>gRNA.f+e
Plasmid#99139PurposeEmpty gRNA scaffold with "Flip" and "Extension" modifications with optimized chicken specific U6 promoterDepositorInsertgRNA
UseCRISPRPromoterchicken U6.3Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only