We narrowed to 15,163 results for: GRN
-
Plasmid#186023Purposeknock out DHODH in mammalian cellsDepositorAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pQCascade-IS186
Plasmid#140627PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS186. The crRNA-IS186 targets IS186 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS186
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBY2_ligD(FnCpf1)
Plasmid#104623PurposeCRISPR system used to genome editing in Mycobacterium smegmatis, expresses crRNA to ligDDepositorInsertcrRNA to ligD
UseCRISPRExpressionBacterialPromoterPj23119Available SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGC480
Plasmid#42600DepositorInsertlet-363 cDNA
UseRNAiPromoterT7Available SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
p8103 LentiCRISPR v2 sgNT-2
Plasmid#163313PurposeExpresses Cas9 and a non-targeting control guide RNADepositorInsertsgNT-2
UseCRISPR and LentiviralPromoterU6Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
shNg pA_RC3J1_CAGW
Plasmid#92155PurposeBicistronic AAV construct encoding GFP control and shRNA targeting NgDepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKEW321-MbCas12a-RFP-GFP-array
Plasmid#115661PurposeEncodes an CRISPR array for MbCas12a targeting superfolder GFP and mRFP1DepositorInsertGFP and RFP array for MbCas12
UseCRISPRExpressionBacterialPromoterPlacAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBSU6-shScr/CMV-eGFP
Plasmid#89912PurposeExpress shRNA Scrambled controlDepositorInsertshRNA Scrambled
TagseGFP under separate promoterExpressionMammalianAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-SMYD2_2
Plasmid#36350DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.1-puro-shWRN1
Plasmid#125781Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-CDKN1A
Plasmid#217457PurposeFor CDKN1A (p21) knockoutDepositorInsertCRISPR Cas9 guide for CDKN1A
UseCRISPRExpressionMammalianAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS848∙CsR
Plasmid#199240PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-mtIF3 shRNA_TagRFP657
Plasmid#182367PurposeshRNA targeting mtIF3 mRNADepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSuper-gmiR-124
Plasmid#171555Purposea human miR-124-expressing plasmidDepositorInsertmiR-124 (MIR124-1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_2
Plasmid#102971PurposeSuppression of FXNDepositorInsertshFXN_2 (FXN Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBSU6-shTim23/CMV-eGFP
Plasmid#89795PurposeExpresses shRNA against TIM23 with a separate promoter for expression of GFP.DepositorInsertshRNA Tim23 (Timm23 Mouse)
TagseGFP under separate promoterExpressionMammalianPromoterU6Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
shCTL-mlpx-puro
Plasmid#65232Purposeencodes a non-targeting control shRNADepositorInsertnon-coding shRNA
ExpressionMammalianPromoterPGKAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQCXIN X2/pTER shLUC (w347-1)
Plasmid#17489PurposeRetroviral Luciferase shRNA (H1/TO promoter), 3’LTR insertion, NeoDepositorInsertFirefly Luciferase shRNA
UseRNAi and RetroviralAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSL0812 (pCRISPR(BbsI)_Vch)
Plasmid#200898PurposeExpresses V. cholerae CRISPR RNA from a U6 promoter. The CRISPR array contains two BbsI sites for spacer cloning.DepositorInsertVchCRISPR (entry)
ExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-PKN1 shRNA 4
Plasmid#59978PurposeKnockdown of PKN1DepositorInsertPKN1 shRNA
UseRetroviralAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i1
Plasmid#59612PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEN_TGmiR_Gb2-K
Plasmid#25766PurposeEntry vector withTRE promoter driving mouse G beta 2 miR30-based shRNA with GFP coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pB[U6-3 wex2 PUb-DsRed]
Plasmid#169010PurposeFor germline transformation. Expresses white exon 2 sgRNA and DsRed marker in all cells.DepositorInsertwhite ex2 sgRNA
UsePiggybacExpressionInsectPromoterDrosophila melanogaster U6:3Available SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-HF-tetra-com-vector
Plasmid#132555PurposeVector plasmid expressing high fidelity spCas9 (R691A) and sgRNA scaffold with com replacing the Tetraloop.DepositorInsertsHigh fidelity Cas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1-C911
Plasmid#125784Purposea seed-matched control for pRSITEP-puro-shWRN1DepositorInsertshWRN1-C911 (WRN Human)
UseRNAiAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJUNB.1.0-gDNA
Plasmid#112409PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor JUNBDepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAPM sh2 DNMT1
Plasmid#88885PurposeLentiviral vector expressing shRNA against murine DNMT1DepositorInsertshRNA no.2 DNMT1
UseLentiviralExpressionMammalianPromoterSFFV (spleen focus forming virus)Available SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM sh1 DNMT1
Plasmid#88884PurposeLentiviral vector expressing shRNA against murine DNMT1DepositorInsertshRNA no.1 DNMT1
UseLentiviralExpressionMammalianPromoterSFFV (spleen focus forming virus)Available SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P POLE1_1
Plasmid#160762PurposeSuppress POLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Hygro-sgSIK3
Plasmid#138699PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgSHMT1-G3
Plasmid#83903Purposestable knockoutDepositorInsertSerine hydroxymethyltransferase 1 (SHMT1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry-CrxshRNA
Plasmid#73987PurposeCrx shRNA (mir30 backbone) was inserted into the 3'UTR of mCherry.DepositorInsertshRNA that targets the mouse Crx gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA1
Plasmid#73981PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shAUF1 hairpin 2
Plasmid#52922Purposeexpresses a hairpin specific for human AUF1DepositorAvailable SinceMay 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Sec5
Plasmid#31117DepositorAvailable SinceOct. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
MDH1-shDusp5-2-H2Kb2
Plasmid#17853DepositorAvailable SinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(scrambled)
Plasmid#214733PurposeExpresses mCherry protein in infected and cre positive cellsDepositorInsertanti-Crh shRNA (scrambled) / mCherry
UseAAVAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-PJ23119-PplpT-sfGFP-TrrfB-BsaI-Scaf-L2
Plasmid#196250PurposePlasmid for cloning of a CRISPR-Cas9 guide RNA gene under promoter PJ23119DepositorInsertattL1-GlpT-scGFP-attL2
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgACSL4
Plasmid#186024Purposeknock out ACSL4 in mammalian cellsDepositorInsertAcyl-CoA Synthetase Long Chain Family Member 4 (ACSL4 Human)
UseCRISPR and LentiviralPromoterU6Available SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-shEsr2
Plasmid#120722PurposeLentiviral vector that expresses GFP and an shRNA targeting Esr2 (in pLL3.7).DepositorAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only