171,694 results
-
Plasmid#86708PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the puromycin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2
Plasmid#231999PurposeExpression of mTagBFP2DepositorInsertmTagBFP2
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
mPiezo1-IRES-eGFP
Plasmid#80925Purposeexpresses mouse Piezo1 with GFPDepositorInsertmouse Piezo1 CDS (Piezo1 Mouse)
ExpressionMammalianAvailable SinceNov. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-PLIN3
Plasmid#222426PurposeTo express PLIN3 with mEGFP tag in mammalian cellsDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJR98
Plasmid#187239PurposeCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sitesDepositorInsertCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sites
ExpressionBacterialAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV9)
Viral Prep#20298-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCre
Plasmid#236212PurposeArabinose-inducible Cre recombinaseDepositorInsertCre recombinase
ExpressionBacterialPromoteraraBAD promoterAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
M51 Super 8x FOPFlash (TOPFlash mutant)
Plasmid#12457PurposeControl for beta-catenin reporter. Contains mutated TCF/LEF binding sites upstream of a luciferase reporter.DepositorInsertmutant TCF/LEF binding sites (Ctnnb1 )
UseLuciferaseExpressionMammalianMutationmutant TCF/LEF binding sitesAvailable SinceMarch 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Blast
Plasmid#83480PurposeMammalian expression of Cas9 and sgRNA scaffoldDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralExpressionMammalianMutationReplaced puromycin N-acetyltransferase on the ori…PromoterEF-1αAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)Flag-His-ATM wt
Plasmid#31985PurposeMammalian expression of human ATM with Flag and His tagsDepositorInsertATM wild-type (ATM Human)
TagsFlag and HISExpressionMammalianMutation3' UTR of 400 nucl.Available SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#100843-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.Syn.GCaMP6s.WPRE.SV40 (#100843). In addition to the viral particles, you will also receive purified pAAV.Syn.GCaMP6s.WPRE.SV40 plasmid DNA. Syn-driven GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIEZO1-HaloTag
Plasmid#207834PurposePIEZO1 fusion for biochemistry and live imagingDepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-eGFP-Puro
Plasmid#79823PurposeExpresses human NEUROGENIN2 (hNGN2), eGFP and puromycin resistance gene under control of TetON promoter. This 3rd generation lentiviral vector is used to generate NGN2-iNs from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV PHP.eB)
Viral Prep#50465-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChR2(H134R)-GFP (AAV8)
Viral Prep#58880-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-ChR2(H134R)-GFP (#58880). In addition to the viral particles, you will also receive purified pAAV-Syn-ChR2(H134R)-GFP plasmid DNA. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-rDA3h
Plasmid#208703PurposeExpresses the genetically-encoded fluorescent dopamine (DA) sensor GRAB_rDA3h in neuronsDepositorInsertGPCR activation based dopamine (DA) sensor GRAB_rDA3h
UseAAVPromoterhSynAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTP1112
Plasmid#104158PurposeBacterial expression plasmid of anti-mouse IgG1 Fc nanobody TP1107 (1x Cysteine)DepositorInsertAnti-mouse IgG1 Fc specific nanobody TP1107 (1xCysteine)
Tags14xHistidine tag and NEDD8 from Brachypodium dist…ExpressionBacterialAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
L4440
Plasmid#1654DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRNAiTagsT7p, T7p, lacZN, OriF1>>, OriF1<<ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pACYC-GroEL/ES-TF
Plasmid#83923PurposeCo-expresses cytoplasmic copies of the Gro EL/ES and Trigger Factor protein folding chaperones.DepositorInsertsGro EL/ES
Trigger Factor
ExpressionBacterialPromoterT7Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV1)
Viral Prep#59171-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-Tmem192-3xHA
Plasmid#102930PurposeLentiviral expression of a lysosomal tag (Tmem192-HA)DepositorAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.GCaMP6f.WPRE.SV40 (AAV1)
Viral Prep#100836-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.GCaMP6f.WPRE.SV40 (#100836). In addition to the viral particles, you will also receive purified pAAV.CAG.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Cre
Plasmid#13775PurposeMammalian expression of Cre recombinase from the broadly active CAG promoter/enhancerDepositorInsertCre
UseCre/LoxTagsMycExpressionMammalianPromoterCAGAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
EF1a_CDX2_P2A_Hygro_Barcode
Plasmid#120432PurposeBarcoded lentiviral vector to express CDX2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMusheLL
Plasmid#47023PurposeMouse PV L1 and L2, Bicistronic, too large to self-packageDepositorInsertMu L1+L2
ExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF5_P2A_Hygro_Barcode
Plasmid#120491PurposeBarcoded lentiviral vector to express KLF5 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK793
Plasmid#8827DepositorInsertTEV protease, S219V mutant
TagsHis, MBP (with TEV), and polyarginineExpressionBacterialMutationS219V mutation (improves stability)Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV9)
Viral Prep#59462-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV9)
Viral Prep#20297-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (AAV1)
Viral Prep#62723-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (#62723). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] plasmid DNA. Cre-dependent expression of ChrimsonR-tdTomato under the control of the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomato (Cre-dependent)Available SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV1)
Viral Prep#51502-AAV1PurposeReady-to-use AAV1 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
EJ2GFP-puro
Plasmid#44025DepositorInsertEJ2GFP egfp-based chromosomal break reporter
ExpressionMammalianMutationinsertion of I-SceI, 3 frame stop, and flanking m…PromoterpCAGGSAvailable SinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-hOKMS
Plasmid#51543PurposeInducible expression of polycistronic 2A spaced OCT4-KLF4-MYC-SOX2DepositorAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.hSyn.Cre.WPRE.hGH (AAV Retrograde)
Viral Prep#105553-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pENN.AAV.hSyn.Cre.WPRE.hGH (#105553). In addition to the viral particles, you will also receive purified pENN.AAV.hSyn.Cre.WPRE.hGH plasmid DNA. hSyn-driven Cre expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Sec61b-C1
Plasmid#90994PurposeExpresses mCherry-tagged Sec61b, brightly labels endoplasmic reticulum in mammalian cellsDepositorInsertmCherry-Sec61b (SEC61B Synthetic, Human)
TagsmCherry (red fluorescence)ExpressionMammalianPromoterCMVAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET29a-YS14
Plasmid#66890PurposePolycistronic coexpression of Xenopus laevis histones (H2A, H2B, H3 and H4)DepositorInsertsHis6-Thrombin-Xenopus laevis histones H2A
Xenopus laevis histones H2B
Xenopus laevis histones H3
Xenopus laevis histones H4-Thrombin
TagsH2A, H2B, H3, H4, His6 tag, and ThrombinExpressionBacterialPromoterT7Available SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 asyn WT
Plasmid#36046DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV SYN flex PSAM4 GlyR IRES EGFP
Plasmid#119741PurposeCre-dependent chemogenetic inhibitor expressionDepositorHas ServiceAAV5 and AAV9InsertPSAM4 GlyR IRES eGFP (CHRNA7 Synthetic, Human)
UseAAVExpressionMammalianMutationL131G, Q139L, Y217FPromotersynapsinAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCW-SPI1
Plasmid#162824PurposeDoxycycline-inducible overexpression of human SPI1DepositorAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60226PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
[#GS5-RV] MitoTRACER-Donor
Plasmid#233505PurposeRetroviral construct of the MitoTRACER genetic reporter to be expressed in the donor cellsDepositorInsertMitoTRACER-Donor
UseRetroviral and Synthetic BiologyTagsGFP11 and HA TagExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBASceI
Plasmid#26477PurposeI-SceI endonuclease expression vector with mammalian promoter to introduce a DSB at a genomic I-SceI siteDepositorInsertpCBASceI
TagsHAExpressionMammalianAvailable SinceOct. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV1)
Viral Prep#162375-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV9)
Viral Prep#37825-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HRE-dUnaG
Plasmid#124372PurposeUnaG fluorescent protein reporter for hypoxia-induced factor (HIF) signalingDepositorInsertHRE-dUnaG
UseLentiviralTagsPEST-degron and Myc tagPromoterHRE (HIF responsive element 5x + CMV minimal prom…Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-WT
Plasmid#17608PurposeMammalian expression of HA tagged ubiquitinDepositorAvailable SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
Caspase-Reporter
Plasmid#243673PurposeFluorescent Reporter for Caspase 3/7 activity. Contains DEVD sequence.DepositorInsertSplit-GFP with DEVD sequence and T2A mCherry
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only