165,421 results
-
Plasmid#154014PurposeVector based on the iOn integration-coupled transcriptional switch (Kumamoto et al bioRxiv 2019) expressing the fluorescent protein mRFP1 from a CAG promoter upon action of the piggyBac transposaseDepositorInsertmRFP1
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FIRE-pHLy
Plasmid#170775PurposeRatiometric biosensor expressed with CMV promoter for probing lysosomal pH in mammalian cellsDepositorInsertLAMP1 (LAMP1 Human)
UseLentiviralTagsmCherry and mTFP1ExpressionMammalianMutation84 nucleotide Signal Sequence switched to the beg…PromoterCMVAvailable sinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LC3-RFP-LC3ΔG
Plasmid#168997PurposeExpresses GFP-LC3-RFP-LC3ΔG in mammalian cells and zebrafish to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseTagsEGFP and mRFP1ExpressionMammalianMutationPromoterAvailable sinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-hM4D(Gi)-mCherry
Plasmid#50461PurposeDouble floxed Gi-coupled hM4D DREADD fused with mCherry under the control of EF1a promoterDepositorInserthM4D(Gi)-mCherry (CHRM4 Human)
UseAAVTagsHA and mCherryExpressionMutationSee supplemental documents for DREADD mutationsPromoterEF1aAvailable sinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
3xAP1pGL3 (3xAP-1 in pGL3-basic)
Plasmid#40342DepositorInsert3xAP-1
UseLuciferaseTagsLuciferaseExpressionMammalianMutationContains three canonical AP-1 binding sites (TGAC…PromoterAvailable sinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSM-mStayGold
Plasmid#234317Purposecodon-optimized mStayGold with synthetic introns for the expression in C. elegansDepositorInsertC. elegans codon optimized mStayGOld
UseTagsmStayGoldExpressionWormMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV1)
Viral Prep#44361-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-NbALFA
Plasmid#159987PurposeFor the expresson and purification of the mCherry-tagged anti-ALFA tag nanobody (NbALFA)DepositorInsertmCherry-NbALFA
UseTags8histidine-HRV3C protease cleavage siteExpressionBacterialMutation3GS linker between mCherry and NbALFAPromoterAvailable sinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas3
Plasmid#209427PurposePlasmid for CASCADE-Cas3 based genome engineering of streptomycetesDepositorInsertcodon optimized minimal type I-C CASCADE-Cas3 from Pseudomonas aeruginosa
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPtipA; crRNA under control of PermE*Available sinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_T2A_mCherry sg1-sg2
Plasmid#192479PurposeAll-in-one plasmid containing both guides for cutting BFP region in DSB Spectrum V1DepositorInsertSpCas9
UseTagsT2A mCherryExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-enAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nuc)-3xHA (AAS1815)
Plasmid#107942PurposeMammalian expression plasmid for human codon optimized enAsCas12a-HF1 (enhanced high-fidelity AsCas12a) encoding E174R/N282A/S542R/K548R substitutionsDepositorInserthuman codon optimized enAsCas12a-HF1 (E174R/N282A/S542R/K548R)
UseTags3x HA and NLS (nucleoplasmin)ExpressionMammalianMutationE174R, S542R, K548R, and N282APromoterCAGAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDonor MCS Rosa26
Plasmid#37200DepositorInsertsRosa26 left targeting arm
MCS
Rosa26 right targeting arm
UseGenomic targeting - zinc fingerTagsExpressionMutationPromoterAvailable sinceJuly 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT_HaloTag7-SNAP-tag2-NLS-P2A-NLS-mTurquoise2
Plasmid#226514PurposeMamalian cell expression of nuclear HaloTag7-SNAP-tag2 and nuclear mTurquoise2DepositorInsertHaloTag7-SNAP-tag2-NLS-P2A-NLS-mTurquoise2
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-HA-hM3D(Gq)-IRES-mCitrine
Plasmid#50463PurposeGq-coupled hM3D-IRES-mCitrine under the control of human synapsin promoterDepositorInserthM3D(Gq)-IRES-mCitrine (CHRM3 Human)
UseAAVTagsHAExpressionMutationSee supplemental documents for DREADD mutationsPromoterhuman Synapsin 1Available sinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b crRNA backbone
Plasmid#103854PurposeFor cloning of guide RNAs compatible with PspCas13b. Contains a 3' direct repeat. Clone using BbsI (BpiI). F overhang cacc. R overhang caacDepositorHas ServiceCloning Grade DNAInsertU6-BbsI-BbsI-PspCas13b DR-polyT
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 28, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
Bison sgRNA library
Pooled Library#169942PurposeThe BISON CRISPR library targets 713 E1, E2, and E3 ubiquitin ligases, deubiquitinases, and control genes and contains 2,852 guide RNAs. It was cloned into the pXPR003.DepositorUseLentiviralAvailable sinceSept. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Mito-7
Plasmid#55102PurposeLocalization: Mitochondria, Excitation: 587, Emission: 610DepositorInsertMito (COX8A Human)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)-mCherry (AAV2)
Viral Prep#50474-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA. hSyn-driven hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable sinceOct. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
mcherry-DN KASH
Plasmid#125553Purposemcherry labeled DN-KASHDepositorInsertSYNE1 (SYNE1 Human)
UseTagsmcherryExpressionMammalianMutationTruncated form: only the KASH domain of nesprin-…PromoterCMVAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
4xHRE-MinTK-CRE-ODD
Plasmid#141147Purposelentiviral expression vector to generate a hypoxia fate-mapping systemDepositorInsert4xHRE-MinTK-CRE-ODD
UseLentiviralTagsExpressionMutationcontains an altered Cre gene modified by the addi…PromoterAvailable sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-GCaMP6f (AAV1)
Viral Prep#128315-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Ef1a-fDIO-GCaMP6f (#128315). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-GCaMP6f plasmid DNA. EF1a-driven, Flp-dependent expression of calcium sensor GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsNoneAvailable sinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_050
Plasmid#96925Purposelentiviral expression of gRNA scaffoldDepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO EYFP (AAV1)
Viral Prep#27056-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Ef1a-DIO EYFP (#27056). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO EYFP plasmid DNA. EF1a-driven, cre-dependent EYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTagsEYFP (Cre-dependent)Available sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY1623 NOLC1 sgRNA 2
Plasmid#234834PurposesgRNA 2 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 stuffer v3
Plasmid#158046Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA casette (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGP-AAV-syn-jGCaMP7s-WPRE (AAV PHP.eB)
Viral Prep#104487-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-syn-jGCaMP7s-WPRE (#104487). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven GCaMP7s calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS:mCherry
Plasmid#170994PurposeUAS:GAL4 repeat-containing promoter drives simple mCherry reporter gene. Blasticidin selectable.DepositorInsertUAS:mCherry
UseLentiviral and Synthetic BiologyTagsExpressionMammalianMutationPromoterSynthetic 14x UAS:Gal4Available sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-Cre-4x6T
Plasmid#196410PurposeAstrocytic expression of Cre recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorHas ServiceAAV5InsertCre
UseAAV; Astrocyte-selectiveTagsExpressionMammalianMutationPromoterCAG and GfaABC1DAvailable sinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAV1K-T5-gfp
Plasmid#26702DepositorInsertT5lacOlacOeGFP biobrick
UseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT4/HB
Plasmid#108352PurposeOptimized Sleeping Beauty Transposon Vector with MCSDepositorTypeEmpty backboneUseTransposonTagsExpressionMutationPromoterAvailable sinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP (AAV5)
Viral Prep#50457-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-DIO-EGFP (#50457). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-EGFP plasmid DNA. hSyn-driven, Cre-dependent EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available sinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-lck-jGCaMP8f (AAV9)
Viral Prep#176759-AAV9PurposeReady-to-use AAV9 particles produced from pZac2.1-GfaABC1D-lck-jGCaMP8f (#176759). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-lck-jGCaMP8f plasmid DNA. GfaABC1D-driven expression of membrane-bound calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGfaABC1DTagsNoneAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MoClo Yeast Secretion and Display (YSD) Toolkit
Plasmid Kit#1000000240PurposeThe YSD Toolkit is a collection of 34 plasmids that can be used in conjunction with the MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest in yeast.DepositorAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV2)
Viral Prep#51502-AAV2PurposeReady-to-use AAV2 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available sinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHCMV_Bless
Plasmid#207255PurposeMammalian expression of Baboon Endogenous Retrovirus env proteinDepositorInsertBaboonEndogenousRetrovirus_Rless_env
UseTagsExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailable sinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-M2rtTA
Plasmid#60843PurposeAAVS1 donor vector for genomic targetingDepositorInsertsM2rtTA
Neo
UseTargeting donorTagsExpressionMutationPromoterAvailable sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiV2-hU6-evopreQ1
Plasmid#210189PurposepegRNA/ngRNA library cloningDepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam APC
Plasmid#16507DepositorInsertAPC (APC Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only