We narrowed to 11,308 results for: ENA
-
Plasmid#99226PurposeBacterial expression of the primed conversion capable protein pr-mEos4b (mEos4b-V69T).DepositorInsertpr-mEos4b
ExpressionBacterialMutationV69T for primed conversion applicationsPromoterT7Available SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-TNKS-2
Plasmid#154149PurposeFor making TNKS-2 RNADepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
R0010 (pLacI)_AB
Plasmid#66004PurposeMoClo Basic Part: Controllable promoter - pLacI - lacI regulated (repressed by LacI+CAP. LacI, C0012, inhibited by IPTG) [A:R0010:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-N–SaKKH-Cas9(D10A)
Plasmid#157839Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertG1397 DddAtox-N–SaKKH-Cas9(D10A)–UGI–SV40 NLS
ExpressionMammalianAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPPC001
Plasmid#171138PurposeFor integration of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T methodDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf42
Plasmid#12730PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf42
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEXNKI-GST-3C-LIC
Plasmid#108710PurposeExpression of a GST-tagged target protein with 3C protease cleavage site.DepositorTypeEmpty backboneTagsGST-3C protease cleavage siteExpressionBacterialPromotertacAvailable SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPKm-196
Plasmid#90511PurposepcDNA3 - CMVmin PIF6-DBD, expressing PIF6-DBD under CMV promoterDepositorInsertPIF6-DBD
ExpressionMammalianAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV-MS2-TV
Plasmid#136381PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-TV fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-TV
UseCRISPRExpressionPlantMutationD570AAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pChlr-8CQ
Plasmid#52171PurposeEncodes module 8 with amino acids 12C-16Q for recognition of nt 1ADepositorInsertPumilio homology domain amino acids 284-319 (PUM1 Human)
ExpressionBacterialMutationChanged 12N to 12C in module 8Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf196
Plasmid#12884PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf196
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 PE2-3HA
Plasmid#169853PurposeMammalian Expression, SpyCas9 prime editor with 3HA-tagDepositorInsertSpCas9-H840A-M-MLV-3HA
Tags3XHA tag and bpSV40 NLSExpressionMammalianPromotercmvAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf117
Plasmid#12805PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf117
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pETNKI-strepII-3C-LIC-kan
Plasmid#108706PurposeExpression of a StrepII-tagged target protein with 3C protease cleavage site.DepositorTypeEmpty backboneTagsStrepII-3C protease cleavage siteExpressionBacterialPromoterT7Available SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL7.0-iRFP670-micro
Plasmid#135954PurposeExpresses an iLID micro (SspB R73Q)-iRFP670 fusion in mammalian cells.DepositorInsertiLID micro (SspB R73Q)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
BRD4 CRISPRi plasmid
Plasmid#154890PurposeHuman BRD4 CRISPRi gRNADepositorInsertBRD4-targeting gRNA
UseCRISPR and LentiviralAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1010m (RFP)_CD
Plasmid#66033PurposeMoClo Basic Part: CDS - Fluorescent protein. Red. Modified from Bba_E1010 to fix illegal sites. [C:E1010m:D]DepositorInsertFluorescent reporter - RFP
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_GSK3B
Plasmid#111687PurposeMAC-tagged gene expressionDepositorInsertGSK3B (GSK3B Human)
ExpressionMammalianAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDsRed2-C1-Ahi1
Plasmid#30495DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMS6: pHelper(AvCAST)_entry_ΔTnsD
Plasmid#168139PurposeInducible expression of AvCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsAvCAST minimal CRISPR array
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g1)-PGKpuroBFP-W
Plasmid#105025PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i1
Plasmid#59612PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2121
Plasmid#91065PurposeModule B, Promoter: GmUbi, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterGmUbiAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-RIPK3 2KR(55,363)
Plasmid#78811PurposeTo overexpress RIPK3 2KR(55,363) in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2516
Plasmid#91084PurposeModule C, Promoter: At7SL, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAt7SLAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClβ.CreON
Plasmid#196996PurposeCre recombinase dependent expression of GluClv2.0 beta subunit. GluClβ contains a YFP tag. When co-expressed with GluClv2.0 alpha subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClβ -YFP
UseAAV and Cre/LoxTagsYFPPromotershort CAGAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-BirA(R118G)-YFP-NLS
Plasmid#127365PurposeBinary vector for expressing nuclear BirA* (R118G)-YFP under the UBQ10 promoter in plantsDepositorInsertBirA* (R118G mutant)
TagsGS linker, NLS, V5, and YFPExpressionPlantMutationR118GPromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22D
Plasmid#91136PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i2
Plasmid#59613PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD6A (OTU, aa 128-288)
Plasmid#61417PurposeExpresses human OTUD6A (OTU domain) in E. coli.DepositorInsertOTUD6A (OTUD6A Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-127.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf166
Plasmid#12854PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf166
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pVRa12_807
Plasmid#49663DepositorInsertECF12_807
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable SinceJan. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJMP1341
Plasmid#119272Purposecontrol sgRNA in cells lacking rfpDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf207
Plasmid#12895PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf207
ExpressionMammalianMutation*Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pK-SAN1-Flag
Plasmid#117163PurposeExpresses Flag-tagged SAN1 nuclease in mammalian cells.DepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEY61
Plasmid#191058Purposeacr-2(3.7k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RIPK1 K163R
Plasmid#78844PurposeTo overexpress RIPK1 K163R in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pDIRECT_21D
Plasmid#91131PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Delta DED FLIP-L D/A
Plasmid#13791DepositorInsertDELTA DED FLIP LONG (CFLAR Human)
Tags8 x His tagExpressionBacterialMutationDelta DED removes first 186 residues Asp to Ala m…Available SinceJan. 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD6B (OTU, aa 133-293)
Plasmid#61419PurposeExpresses human OTUD6B (OTU domain) in E. coli.DepositorInsertOTUD6B (OTUD6B Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-132.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_BET1
Plasmid#111683PurposeMAC-tagged gene expressionDepositorInsertBET1 (BET1 Human)
ExpressionMammalianAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only