We narrowed to 9,360 results for: CAG
-
Plasmid#86323PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC-cUnaG-P2A-nUnaG-ST-P2A-mCh
Plasmid#207634PurposeA plasmid encoding photocaged SpyCatcher (pSC)-cUnaG, nUnaG-SpyTag (ST), and mCherry separated by P2A cleaving sequences for mammalian expression.DepositorInsertphotocaged SpyCatcher-cUnaG-P2A-nUnaG-SpyTag-P2A-mCh
ExpressionMammalianMutationAmber stop codon at SC's critical lysinePromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pColdI-SBP-eIF4A1
Plasmid#233621PurposeExpression of SBP-tagged eIF4A1 in E.coliDepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PRKAG3 gRNA (BRDN0001146704)
Plasmid#77294Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAG3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SPHK1 gRNA (BRDN0001148403)
Plasmid#76815Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-CEP135
Plasmid#227286PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CEP135 for knock-in.DepositorInsertsgRNA Targeting N-terminus of CEP135 (CEP135 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
rAAV-U6-MeCP2shRNA-CamKIIa-mCherry
Plasmid#169704PurposeMeCP2 KnockdownDepositorInsertshRNA against MeCp2 (Mecp2 Mouse)
UseAAVAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_1
Plasmid#215236PurposeSupression of shcircHUWE1(19,20)_1 expressionDepositorInsertcircHUWE1 shRNA 1 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TNIK gRNA (BRDN0001146045)
Plasmid#75849Purpose3rd generation lentiviral gRNA plasmid targeting human TNIKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut AP-1+C/EBP
Plasmid#61292Purposedrives luciferase from mouse IL-6 promoter with mutations in both AP-1 & C/EBP sitesDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated both AP-1 binding site from TGAGTCT to TG…PromoterIL-6 promoter with mutant AP-1 and C/EBP binding …Available SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/empty
Plasmid#105505PurposeEmpty backbone of MSCV-driven retroviral cDNA expressionDepositorTypeEmpty backboneUseRetroviralAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
Plasmid#185676PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1DepositorInsertERN1 gRNA (ERN1 Human)
UseCRISPRAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pSC-mCh-P2A-ST-EGFP-CAAX
Plasmid#207636PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to mCherry and a SpyTag-EGFP localized to the cell membrane via CAAX tagDepositorInsertphotocaged SpyCatcher-mCh-P2A-SpyTag-EGFP-CAAX
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_2
Plasmid#215235PurposeSupression of shcircHUWE1(19,20)_2 expressionDepositorInsertcircHUWE1 shRNA 2 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
ROSA26(MultiFPsΔPuro)
Plasmid#140759PurposeTargeting vector to Gt(ROSA)26 locus for conditional expression of distinct FPs (Venus, mCherry, and mCerulean) responding to each site-specific-recombinase activity (Cre, Dre, and phiC31o).DepositorInsertspuromycin-N-acetyltransferase
Venus
mCherry
mCerulean
UseMouse TargetingPromoterCAGGSAvailable SinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgBLM10
Plasmid#127643PurposeKnock-out of human BLMDepositorInsertIRF3 sgRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank2-GFP KI
Plasmid#131496PurposeEndogenous tagging of Shank2: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shSmad2
Plasmid#37051DepositorAvailable SinceJan. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001145952)
Plasmid#76714Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SBC015866
Plasmid#226280PurposeExpresses BsSfp, MsCAD, and SrCAR from trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pORANGE Doc2A-GFP KI
Plasmid#131478PurposeEndogenous tagging of Doc2a: C-terminal (amino acid position: L402)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN4
Plasmid#52679PurposeshRNA against α-actinin-4 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Crys
Plasmid#164967PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgCry1_2-hU6-sgCry2_1-hU6-sgCry2_2
UseAAVTagsmCherryPromoterhU6, hSynAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
OR6K6_Deletion_gRNA1
Plasmid#195195Purposedual gRNAs for deletion of OR6K6 in a third generation Cas9 backbone with GFPDepositorInsertOR6K6 dual gRNA (OR6K6 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AA286
Plasmid#215948PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v6; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Hygro-sgSIK3
Plasmid#138699PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-Ataxin3-1-182
Plasmid#22115DepositorAvailable SinceSept. 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-2
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_IL1RN
Plasmid#64151PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
Plasmid#210504Purposeexpresses NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry component in mammalian cellsDepositorInsertNES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3261
Plasmid#115458PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
px335-EF-Slc2a3-L
Plasmid#122304PurposeExpresses sgRNA targeting mouse Slc2a3 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Slc2a3 (Slc2a3 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_IL1RN
Plasmid#64142PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK3
Plasmid#138697PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_1
Plasmid#36335DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
MSCV-TRE-dsRed-miR30_shBrd9_1061-PGK-Venus-IRES-NeoR
Plasmid#75135PurposeRetroviral expression plasmid encoding inducible shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable SinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v2-mU6-sgCebpb_v2-hU6-sgCebpd_v2
Plasmid#177258PurposeExpresses Cebpa_v2 (bU6), Cebpb_v2 (mU6), Cebpd_v2 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpb_v2/sgCebpd_v2
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_2
Plasmid#135753PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIM27 gRNA (BRDN0001149307)
Plasmid#77515Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM27DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP1LC3A-V1
Plasmid#98569PurposeExpresses MAP1LC3A-V1DepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only