We narrowed to 18,985 results for: INO
-
Plasmid#217801PurposeVariant CE1 construct with SaCas9, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSaCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSaCas9(N580A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available sinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-ChRmine-oScarlet
Plasmid#137159PurposeIntersectional viral expression of ChRmine-p2a-oScarlet in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-ChRmine-p2a-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationoScarlet E95DPromoternEFAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNCS-mGold2s
Plasmid#231765PurposeExpression of mGold2s in bacterial cellsDepositorInsertmGold2s
UseTagsExpressionBacterialMutationmGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterSynthetic promoterAvailable sinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET32bplus_trxAChEwt
Plasmid#83916PurposeEncodes an E. coli codon optimized version of wild type human acetylcholinesteraseDepositorInsertShort form of hAChE, codon optimised for E.coli expression (ACHE Synthetic, Human)
UseTagsHis, S-tag, and TRXExpressionBacterialMutationcodon optimised for E.coli expressionPromoterT7 promoterAvailable sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Δ18 D614G
Plasmid#164437PurposeEncodes SARS-CoV-2 Spike Protein lacking 18 C-terminal amino acids and D614G mutation for pseudovirus productionDepositorInsertSARS-CoV-2 Spike D614G variant truncated to remove 18 amino acids (S )
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
UseTagsExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable sinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-NLSmCherryNLS Clover-HDHB
Plasmid#190223PurposeFluorescent cell cycle reporterDepositorInsertsUseTransposonTagsClover fluorescent proteinExpressionMammalianMutationAmino Acids 994-1087PromoterEF1a and RPBSAAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mAC-POLR2A donor (Hygro)
Plasmid#124496PurposeA donor plasmid for tagging the N-terminus of human POLR2A with mAID-mCloverDepositorInsertPOLR2A homology arms and Hygro-P2A-mAID-mClover (POLR2A Human)
UseCRISPRTagsmAID-mCloverExpressionMutationPromoterAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1C
Plasmid#224438PurposeRep/Cap plasmid for the production of MyoAAV 1C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDLSTP insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-RKIP_RFP
Plasmid#199215PurposeRKIP (PEBP1) expression plasmid with a RFP reporter on the backbone.DepositorInsertsUseTagsExpressionMammalianMutationPromoterCMV and PGKAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-CD20-Puro
Plasmid#209757PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-iC++-EYFP
Plasmid#137156PurposeIntersectional viral expression of ic++-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-iC++-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationn/aPromoternEFAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD deltahexa
Plasmid#169714PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, hexapeptide including aa 259-264 deletedDepositorInserthnRNPA1 (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K963_GFP_SNAP
Plasmid#159727PurposeExpresses kinesin-1 (amino acids 1-963) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (full length, 1-963 amino acids), K963 (KIF5B Human)
UseTagsGFP and SNAP tags and ZZ affinity tagExpressionInsectMutationPromoterAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER22-MKK6E-Flag
Plasmid#99259PurposeLentiviral vector encoding a doxycycline-inducible Flag-tagged constitutively active MKK6.DepositorInsertMKK6E (MAP2K6 Human)
UseLentiviralTagsFlagExpressionMammalianMutationS207E T211EPromoterTRE2Available sinceAug. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-NpHR3.3-EYFP
Plasmid#137152PurposeIntersectional viral expression of NpHR3.3-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-NpHR3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationW179FPromoternEFAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-T4DNApol (JO638)
Plasmid#208956PurposeA variant CE1 construct with T4 DNA polymerase (-exo, activity enhanced), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-T4pol-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), T4Pol(-exo;D189A/E191A/L412M)PromoterCMV and T7Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBabe.puro.CDK8.KD.flag
Plasmid#19759DepositorInsertcyclin-dependent kinase 8 (CDK8 Human)
UseRetroviralTagsFlagExpressionMammalianMutationD173A (kinase dead)PromoterAvailable sinceDec. 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-HsACE2 (human)
Plasmid#158081PurposeExpresses human ACE2 in mammalian cellsDepositorInsertHuman ACE2 (ACE2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-DCV-nCas9-EcKlenow (JO608)
Plasmid#208946PurposeA variant CE1 construct with DCV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertDCV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-oScarlet
Plasmid#137137PurposeIntersectional viral expression of oScarlet in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE95DPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2E
Plasmid#224441PurposeRep/Cap plasmid for the production of MyoAAV 2E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDQGYQ insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3D
Plasmid#224445PurposeRep/Cap plasmid for the production of MyoAAV 3D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYREL insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3E
Plasmid#224446PurposeRep/Cap plasmid for the production of MyoAAV 3E, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4B
Plasmid#224449PurposeRep/Cap plasmid for the production of MyoAAV 4B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYTSV insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4D
Plasmid#224451PurposeRep/Cap plasmid for the production of MyoAAV 4D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4C
Plasmid#224450PurposeRep/Cap plasmid for the production of MyoAAV 4C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYTSM insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3C
Plasmid#224444PurposeRep/Cap plasmid for the production of MyoAAV 3C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYSSV insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3B
Plasmid#224443PurposeRep/Cap plasmid for the production of MyoAAV 3B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYSGL insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_016-sgATF4-1
Plasmid#202455PurposeExpression of a guide RNA targeting ATF4DepositorInsertATF4 gRNA (ATF4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-EcKlenow fusion - pCMV-T7-PCV2-EcKlenow (JO1421)
Plasmid#217804PurposeUnfused click editor construct expressing PCV2-EcKlenow, expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available sinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29(+exo) (LM2938)
Plasmid#208957PurposeA variant CE1 construct with Phi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX_314-HRI-V5
Plasmid#202434PurposeExpression of HRIDepositorInsertHRI (EIF2AK1 Human)
UseCRISPR and LentiviralTagsV5ExpressionMammalianMutationPromoterEF1alphaAvailable sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FSF-FLEX-EGFP-WPRE-bGHpA
Plasmid#65455PurposeCan be used to generate AAV virus that will express EGFP from the CAG promoter under intersectional control by Flp and Cre recombinasesDepositorInsertEGFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-MSMV-nCas9-EcKlenow (JO661)
Plasmid#208947PurposeA variant CE1 construct with MSMV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertMSMV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-hRPH3A_c.444Gwt
Plasmid#190476Purposeminigene assayDepositorInsertRPH3A (NM_014954.3) c.444 [exon 7 and part of surrounding introns only] (RPH3A Human)
UseTagsExpressionMammalianMutationPromoterSV40Available sinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2(ET/TC)-EYFP
Plasmid#137141PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE123T, T159CPromoternEFAvailable sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-sRGECO
Plasmid#137127PurposeIntersectional viral expression of sRGECO in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-sRGECO
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationE217DPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET
Plasmid#193364Purposeexpression of human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
UseTagsmonomeric GFP (mGFP)ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
plenti-ef1a-dCasRx-FTO-HA-T2A-BSD
Plasmid#177120PurposedCasRx mediated RNA tethering of FTODepositorInsertdCasRx-FTO
UseLentiviralTagsHA and SV40 NLSExpressionMutationdCasRX contains R239A/H244A/R858A/H863A mutations…PromoterEf1aAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 KBTBD4 WT
Plasmid#184624PurposeDoxycycline inducible lentiviral vector for N-terminal Flag tagged KBTBD4 WT expression in mammalian cellsDepositorInsertN-terminal Flag tagged KBTBD4 WT (KBTBD4 Human)
UseLentiviral; Doxycycline inducibleTagsExpressionMammalianMutationno mutationPromoterTRE promoter, Tet ONAvailable sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS D614G soluble Spike
Plasmid#164651PurposeExpresses SARS-CoV-2 soluble Spike protein with a D614G mutationDepositorInsertSARS-CoV-2 soluble spike (S SARS-CoV-2)
UseTagsHISExpressionMammalianMutationD614GPromoterCAGAvailable sinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_YY1_WT
Plasmid#82171PurposeGateway Donor vector containing YY1 , part of the Target Accelerator Plasmid Collection.DepositorInsertYY1 (YY1 Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6M
Plasmid#137120PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationRemoved RSET tagPromoterEF1aAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT3-EFa1-HA-Jag1
Plasmid#46051DepositorInsertJag1 (Jag1 Rat)
UseTagsHA tagExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-NpHR3.3-EYFP
Plasmid#137154PurposeIntersectional viral expression of NpHR3.3-EYFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-NpHR3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationW179FPromoternEFAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only