We narrowed to 26,062 results for: GFP
-
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT3-Neo-EF1a-GFP
Plasmid#69134PurposeSleeping Beaquty (SB) vector encoding G418 resistance and GFP from two separate promotersDepositorTypeEmpty backboneUseSleeping beauty transposonExpressionMammalianPromoterU3MSCVAvailable SinceJan. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGCDNsam-Hnf4a-IRES-GFP
Plasmid#33006DepositorInserthepatic nuclear factor 4 alpha (Hnf4a Mouse)
UseRetroviralAvailable SinceMarch 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-GFP-iCAM-1
Plasmid#205186PurposeThis vector encodes of a synCAM (iCAM1) and GFPDepositorInsertsynCAM iCAM1 and GFP
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCALPS-Flag-Miwi-EGFP
Plasmid#212575PurposeLentiviral expression of Flag-tagged mouse Miwi in mammalian cellsDepositorInsertMiwi (Piwil1 Mouse)
UseLentiviralTags5x Flag and SNAP tagExpressionMammalianPromoterSFFVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE/VEGF/IRES/EGFP
Plasmid#206211PurposeAn expression vector of VEGF and EGFP under control of TRE promoterDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1-Q61L
Plasmid#12981DepositorInsertRac1 constitutively active (RAC1 Human)
TagsEGFPExpressionMammalianMutationQ61L Constitutively activeAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-(pos36)GFP
Plasmid#62937PurposeExpression of 6xHis-(+36)GFP in bacterial cellsDepositorInsert(pos36)GFP
Tags6xHis tagExpressionBacterialPromoterT7Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-0.5Syn-D2GFP-WPRE
Plasmid#233060PurposeTo express D2GFP from a 0.5 bp synapsin promoter.DepositorInsertD2GFP
UseLentiviralAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFSp-GFP-YAP (5SA)
Plasmid#174170PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the EFS promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterEFSAvailable SinceSept. 28, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-GFP
Plasmid#58806PurposeAAV expression of ChrimsonR-GFP under the Syn promoterDepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationK176RPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pTH-iCre:EGFP-WPREpA
Plasmid#213142PurposeTruncated rat TH promoter expressing iCre fused to EGFPDepositorInsertiCre
UseAAVTagsEGFPExpressionMammalianPromoterTruncated TH promoter from rat (Rattus norvegicus…Available SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-GFP-Ecad
Plasmid#205188PurposeThis vector encodes of a synCAM (Ecad) and GFPDepositorInsertsynCAM Ecad and GFP
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-GFP-progerin
Plasmid#17663DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
cfSGFP2-anti-AlfaTag nanobody
Plasmid#171818PurposeBacterial expression vector for production of fluorescent anti-AlfaTag nanobodyDepositorInsertcfSGFP2-anti-AlfaTag nanobody
Tags6xHis and SEP tag (6xD)ExpressionBacterialAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 GFP-NShroom3-iLID
Plasmid#170976PurposeN-terminal component of OptoShroom3 optogenetic tool. Binds to apical junctions. pDONRp5-p2 plasmid.DepositorInsertNShroom3 (Shroom3 Mouse)
UseGateway cloningTagseGFP and iLIDMutationFrom isoform 2, deleted amino acids 1389 - 1805,…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHBS1389 IBB-GFP-mCherry3E
Plasmid#118803PurposeFluorescence-based TDP43-dependent splicing reporterDepositorInsertSynthetic
ExpressionMammalianAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
P3-dCas9-Tet1-GFP-Puro
Plasmid#190728PurposeExpression of human spdCas9-Tet1 fusion for targeted DNA methylation in mammalian cell. EGFP-puromycin double marker under an independent CMV promoter. Cloning backbone for spgRNA (BbsI)DepositorInsertdCas9-tet1
UseCRISPRTags3XFLAG and SV40 NLSExpressionMammalianMutationChanged Pro434 codon from CCG to CCC and Gly468 f…PromoterpCAGAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLPCX mito Grx1-roGFP2
Plasmid#64977PurposeMammalian expression of mitochondrial Grx1-roGFP2 (retroviral vector)DepositorInsertGlutaredoxin-1 (GLRX Human)
UseRetroviralTagsroGFP2ExpressionMammalianMutationmitochondrial targeting sequenceAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
LncRNA overexpression EF1α_BbsI_SV40 polyA_EGFP
Plasmid#219828PurposeOverexpression vector for non-coding RNAs driven by EF1α promoter with GFP. Cloning using BbsI.DepositorTypeEmpty backboneExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMRX-IPU-GFP-MYH9
Plasmid#168273PurposeExpresses MYH9 in mammalian cellsDepositorAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-eGFP-Kindlin 1
Plasmid#203733PurposeAAV vector plasmid expressing mouse kindlin-1 fused to eGFP under the human synapsin (SYN) promoterDepositorInsertFermt1 (Fermt1 Mouse)
UseAAVTagseGFPExpressionMammalianPromoterHuman synapsin promoterAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 VDAC1-Linker-GFP
Plasmid#211734PurposeExpresses GFP tagged VDAC1 in mammalian cells. GFP is attached to the C-terminus of VDAC1 with a flexible linker.DepositorAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-TetON-mEGFP-MYOD1_AroPERFECT
Plasmid#215620PurposeFor integration of MYOD1 AroPERFECT T2A mEGFPDepositorAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
4xHRE_YB TATA-sfGFP-CMV_dsRed
Plasmid#117399PurposesfGFP expressed from hypoxia-inducible YB_TATA promoter and dsRed expressed from consitutive CMV promoterDepositorInsertSuperFolder GFP
ExpressionMammalianAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-Flag-GFP_IDG-K
Plasmid#135275PurposeGateway destination clone of GFP (as control) tagged with N-terminal Flag for generating protein-protein networks using fusion tag affinity-based proteomicsDepositorInsertFlag-GFP
UseLentiviral; Gateway destinationTagsFlagExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo FlucDM EGFP
Plasmid#90172PurposeEGFP-tagged constructs to monitor the aggregation state of the sensors and the ability of cells to solubilize or degrade the aggregated proteins. FLuc contains double mutationDepositorInsertFLuc EGFP
ExpressionMammalianMutationR188Q, R261Q in FLucAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-ChR2-GFP
Plasmid#26929PurposeAAV-mediated expression of ChR2-GFP for neuronal excitationDepositorInsertChR2
UseAAV; Adeno-associated virusTagsGFPExpressionMammalianPromoterCAGAvailable SinceJan. 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2-SP-FRB (T2098L) -sfGFP-TM-V5
Plasmid#186227PurposemRNA synthesis of rapalog-induced cell adhesion moleculeDepositorInsertmRNA synthesis of rapalog-induced cell adhesion molecule
TagsV5ExpressionMammalianMutationFRB (T2098L)Available SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sec61 beta pAcGFP-C1 (802)
Plasmid#62008Purposemammalian expression of GFP-Sec61 betaDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC034 - LwCas13a-msfGFP-2A-Blast
Plasmid#91924PurposeExpresses active LwCas13a for mammalian RNA targeting with Blasticidin selection markerDepositorInsertLwCas13a
UseCRISPR and LentiviralTagsNLS and msfGFP-NLS-3xHA, P2A, BlasticidinExpressionMammalianPromoterEFSAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPCX cyto Grx1-roGFP2
Plasmid#64975PurposeMammalian expression of cytosolic Grx1-roGFP2 (retroviral vector)DepositorAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-GFP-ATL2
Plasmid#109020Purposestable lentiviral expression of cDNADepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGG-GOI-DE-TurboID-GFP
Plasmid#209389PurposeGolden Gate compatible plasmid for TurboID-based proximity labelling experiment in plantaDepositorTypeEmpty backboneTagsGFPExpressionPlantMutationTurboID gene sequence C249AAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK172-α-syn-TEV-GFP
Plasmid#166671PurposeBacterial expression of alpha synuclein coupled to GFP via a TEV site for uptake studiesDepositorInsertmouse synuclein (from V. Lee) (Snca Mouse)
TagsGFPExpressionBacterialMutationadded a TEV cleavage site sequence between synucl…PromoterCMVAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
IRE1 alpha-pcDNA3.EGFP
Plasmid#13009DepositorInsertInositol Requiring Enzyme-1 (ERN1 Human)
ExpressionMammalianAvailable SinceNov. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
MSCV-LMP1-IRES-GFP
Plasmid#220350PurposeExpresses EBV latent gene LMP1 in mammalian cellsDepositorAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S(rc)2_4_5-GFP
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB_EF1a-DjCas13d-msfGFP-Blast
Plasmid#226008PurposeDjCas13d protein for RNA targeting in piggyBac backboneDepositorInsertDjCas13d RNA-targeting nuclease
UseCRISPRTagsmsfGFPExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Mycn-IRES-GFP
Plasmid#35394DepositorAvailable SinceFeb. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pACUH-GFP1-10 mitochondrial matrix
Plasmid#172063PurposeUAS vector to express GFP1-10 in the mitochondrial matrixDepositorInsertGFP1-10 mitochondrial matrix
ExpressionInsectAvailable SinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pZS2oxySp-GFP-proD-oxyR
Plasmid#78224Purposesynthetic gene circuitDepositorInsertsynthetic gene circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mBAF45a IRES GFP
Plasmid#17880DepositorAvailable SinceMay 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
MTS-mCherry-GFP1-10-Hyg-N1
Plasmid#91957PurposeExpresses mCherry-GFP1-10 in mammalian cell mitochondriaDepositorInsertMTS-mCherry-GFP1-10
ExpressionMammalianPromoterCMVAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-GFP-JAM-B
Plasmid#205191PurposeThis vector encodes of a synCAM (JAM-B) and GFPDepositorInsertsynCAM JAM-B and GFP
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE-GFP-Blast
Plasmid#135673PurposeDox-inducible expression (TRE promoter) of GFP cDNA (control for other cDNAs), Blasticidin selectionDepositorInsertGFP
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only