We narrowed to 8,824 results for: AMPH
-
Plasmid#192274PurposeEncodes MmCas12m under a constitutive promoterDepositorInsertMmCas12
UseCRISPRExpressionBacterialPromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIA123
Plasmid#234038PurposeE. coli-C. difficile shuttle vector for CRISPR editing in C. difficile. Pxyl::Cas9-opt Pgdh::sgRNA-cdr_0985. PstI site to add DNA for homology directed repair. MscI and NotI for replacement of sgRNA.DepositorInsertsCas9
sgRNA
UseCRISPRExpressionBacterialPromoterPgdh and PxylAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
plenti-ATF4
Plasmid#125238PurposeATF4 expression vectorDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTUM4
Plasmid#230905PurposePlasmid encoding four periplasmic folding helper proteins to boost the secretion of functional heterologous proteins in E. coliDepositorInsertsExpressionBacterialAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9_ctrl
Plasmid#100981PurposeExpresses ThermoCas9 and its sgRNA moduleDepositorInsertsCas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialPromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m
Plasmid#192275PurposeEncodes MmdCas12m (D485A) under a constitutive promoterDepositorInsertMmdCas12m
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-N (TRP1)
Plasmid#177797PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneTagsDHFR F[1,2]ExpressionYeastPromoterADH1Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway CloningExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-cDNA5-FRT/TO-3*Flag-APEX2 N-term
Plasmid#182925PurposeExpress FLAG epitope and APEX2-tagged fusion protein in mammalian cells.DepositorTypeEmpty backboneTagsAPEX2 and FLAGExpressionMammalianPromoterCMVAvailable SinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-cDNA5-FRT/TO-3*Flag-APEX2 C-term
Plasmid#182926PurposeExpress FLAG epitope and APEX2-tagged fusion protein in mammalian cells.DepositorTypeEmpty backboneTagsAPEX2 and FLAGExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDESTpK7WG-RPS5Ap-mito
Plasmid#163145PurposePlant mitoTALEN vector assembly, Destination vector for plants to express ORFs from entry clone with mitochondrial presequence under the RPS5A promoterDepositorInsertRPS5A promoter and mitochondrial presequence in front of attR1 in pk7WG
ExpressionPlantAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
VN1852 pB2Hws_v28_pLWeakRBS_TIR371_cI-Asf1B+rpoA-IP4_Ddcm_WeaKRBS_TIR51_KanR
Plasmid#235118PurposeQuantitative bacterial two-hybrid (qB2H). Expresses ASf1B and IP4.DepositorInsertsUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34P-rpoAExpressionBacterialPromoterLtetO and lpp+lacUV5Available SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
VN1316 pB2Hws_v30_pLWeakRBS_TIR371_cI-Asf1B+rpoA-IP4_Ddcm_eGFP-wcKanR
Plasmid#235113PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B and IP4.DepositorInsertsUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34P-rpoAExpressionBacterialPromoterLtetO and lpp+lacUV5Available SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot1iso1_1356-1581_V
Plasmid#147779PurposeBacterial Expression of HsNot1iso1_1356-1581DepositorInsertHsNot1iso1_1356-1581 (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
VN1263 pB2Hws_v28_pLWeakRBS_TIR371_cI-Asf1B+rpoA-IP1_Ddcm_WeaKRBS_TIR51_KanR
Plasmid#235115PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B and IP1.DepositorInsertsUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34P-rpoAExpressionBacterialPromoterLtetO and lpp+lacUV5Available SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarR
Plasmid#31222DepositorInsertCD4-tdTom (CD4 Human, Fly, Aequorea victoria)
TagsCD4 and tdTomatoExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHochTypeIII
Plasmid#214039PurposeBacterial expression plasmid for Haliangium ochraceum type III CRISPR-Cas complex; contains csb2, a minimal CRISPR array with a pTarget spacer, cmr1-6DepositorInsertCas10
UseCRISPRMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
[pSK24] pACYCDuet His-c7orf59|HBXIP
Plasmid#136143Purposebacterial expression of c7orf59 and HBXIPDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-NbmiR482aTS-B/c
Plasmid#227967PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Nicotiana benthamiana.DepositorInsertsB/c
NbmiR482aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneTagsDHFR F[1,2]ExpressionYeastPromoterADH1Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGM32DEST
Plasmid#74747PurposeEncodes for the QF-GR recombinant gene, splice linker, and mCherry reporter geneDepositorInsertsTagsFusion of the Neurospora crassa QF activator to t…ExpressionWormPromoterNo promoterAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB_Tet-Off_Flex_DEST_EFS_mODC_tTA (JDW 936)
Plasmid#229828PurposeA Piggybac-compatible, cre-dependent, Tet-off destination vector with a downstream WPRE. EFS driving destabilized tTADepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarG
Plasmid#31221DepositorInsertCD4-tdGFP (CD4 Human, Fly, Aequorea victoria)
TagsCD4 and EGFP/GFPExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b-HEPN
Plasmid#89901PurposeBacterial expression for bzCas13b and crRNA with both HEPN domains mutated. New spacers can be cloned by digesting with BsaI.DepositorInsertCas13b
ExpressionBacterialMutationR116A/H121A/R1177A/H1182APromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-CMV/TetO2-EYFP-GW
Plasmid#153309PurposeTet-On YFP-tagged Gateway destination vector, to be used together with pT2-TetR-neoR transposon plasmidDepositorTypeEmpty backboneUseTransposonTagsYellow Fluorescent ProteinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
MP6.6TAG_AraC_Para-dnaQ926-dam-seqA-emrR-ugi-CDA1.6TAG
Plasmid#163719PurposeArabinose-inducible expression of six mutagenesis genes, each encoding one amber codon after the initiator methionineDepositorInsertaraC dnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TAG CDA1.1TAG
ExpressionBacterialMutationdnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TA…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBullet-tgn-c
Plasmid#53072Purposedestination vector with ECFP-trans golgi network marker (VTI12) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNAscaffold 2.1 scRNA (GB1437)
Plasmid#160571PurposeVersion of SgRNA scaffold with the sequence 2.1 of Ms2 aptamer in the 3' end.DepositorInsertsgRNAscaffold 2.1 scRNA
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK668
Plasmid#192637PurposeExpresses dCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dCas9-NG ha…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT[Hygro]_GBP-3xFlag-DEST
Plasmid#157813PurposeA gateway plasmid for expression of GBP-3xFlag-fusion protein under the regulation of the copper-inducible metallothionein promoter in Drosophila cells; suitable for hygromycin selectionDepositorInsertGFP-binding protein
UseFor drosophila cellsTags3xFlagExpressionInsectPromotermetallothioneinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-c
Plasmid#53074Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-ccdB-mRuby3
Plasmid#166139PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a CEN/ARS element for low copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-3x-uC-ccdB-6stop
Plasmid#203514PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (3x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-2x-uA-ccdB-6stop
Plasmid#203517PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (2x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-c
Plasmid#53078Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shDyn2
Plasmid#132712PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Pdyn geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_zeo
Plasmid#184917PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_zeo recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-c
Plasmid#53070Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-c
Plasmid#53076Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-er-c
Plasmid#53068Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-c
Plasmid#53066Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shDyn1
Plasmid#132711PurposeEncodes short hairpin RNA (shRNA) #1 that targets the 3’-untranslated region of the rat Pdyn geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only