We narrowed to 16,118 results for: form
-
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-6xHis [N144/14-rat IgG2a] - Chimeric
Plasmid#227037PurposeMammalian expression plasmid of anti-6xHis rat IgG2a R-mAb. Derived from hybridoma N144/14.DepositorInsertAnti-6xHis recombinant mouse monoclonal antibody.
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-∆Hapln1
Plasmid#200778PurposeExpresses mouse HAPLN1 mutant lacking the lectican binding domain and fused with cysteine-free GFP (cfGFP) under synapsin promoterDepositorInsertHyaluronan And Proteoglycan Link Protein 1 (Hapln1 Mouse)
UseAAVTagscfGFPMutationdeleted lectican binding domain (aminoacids 40-15…PromoterSynapsinAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 actin-3XNLS P2A mCherry
Plasmid#58475PurposeExpresses nuclear-targeted human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdICAM1-ST3-His
Plasmid#210666PurposeExpression of the extracellular domain of human ICAM1 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human ICAM-1 fused to Spytag003 and Histag (ICAM1 Human, Synthetic)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1WT
Plasmid#230915PurposeExpression of human COL1A1 promoter and testing the promoter activity with luciferase assay.DepositorInsertHuman COL1A1 promoter (COL1A1 Human)
UseLuciferaseTagsluciferase - Luc2pExpressionBacterial and MammalianPromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMC00030 (aka pRC0707)
Plasmid#209673PurposeLentiviral vector expressing PP7-P65-HSF1DepositorAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
peGFP-N1-Cofilin
Plasmid#186747PurposeExpresses wildtype GFP-tagged human cofilin in mammalian cellsDepositorAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1-cofilin
Plasmid#186750PurposeExpresses wildtype mCherry-tagged human cofilin in mammalian cellsDepositorAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE
Plasmid#104488PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV8, and AAV9InsertjGCaMP7f
UseAAVTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphasL-RLuc8
Plasmid#140981PurposeEncodes a G alpha subunit (GNAS1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphasL-RLuc8 (GNAS Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-YTHDC1-FL-mCherry-Cry2
Plasmid#177124PurposeExpress Full-length YTHDC1 with mCherry and CRY2 tag for Optodroplet AssayDepositorAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ai62(TITL-tdT) Flp-in replacement vector
Plasmid#61576PurposeRecombinase-mediated cassette exchange in ES cells to insert a Cre & tTA-dependent tdTomato expression cassette into a docking site within the mouse TIGRE genomic locusDepositorInsertchromatin insulator flanked TRE-LSL-tdTomato
UseRecombinase-mediated cassette exchange using flp …Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
peGFP-N1-Cofilin-S41E
Plasmid#186748PurposeExpresses S41E phosphomimetic GFP-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsGFPExpressionMammalianMutationChanged serine 41 to glutamic acidPromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
peGFP-N1-Cofilin-S41A
Plasmid#186749PurposeExpresses S41A phosphodead GFP-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsGFPExpressionMammalianMutationChanged serine 41 to alaninePromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1-Cofilin-S41E
Plasmid#186751PurposeExpresses S41E phosphomimetic mCherry-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsmCherryExpressionMammalianMutationChanged serine 41 to glutamic acidPromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
GABA(A)R, Delta scFv [N151/3]
Plasmid#206724PurposeMammalian Expression of GABA(A)R, Delta scFV. Derived from hybridoma N151/3 scFv.DepositorInsertGABA(A)R, Delta (Rattus norvegicus) recombinant scFV (Gabrd Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai3-RLuc8
Plasmid#140975PurposeEncodes a G alpha subunit (GNAI3) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai3-RLuc8 (GNAI3 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-mNeonGreen-BRD4-NUT
Plasmid#204694PurposeThis plasmid allows for inducible expression of full-length BRD4-NUT fusion tagged with mNeonGreen, in mammalian cells.DepositorTagsmNeonGreenExpressionMammalianMutationdirect fusion of BRD4 and NUTPromoterCMVAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai2-RLuc8
Plasmid#140974PurposeEncodes a G alpha subunit (GNAI2) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai2-Rluc8 (GNAI2 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Rasgrf2-2A-dCre targeting vector
Plasmid#61573PurposeTarget a DHFR-destabilized Cre recombinase gene to the stop codon of the mouse Rasgrf2 geneDepositorInsertRasgrf2-2A-dCre (Rasgrf2 Mouse, P1 bacteriophage)
UseCre/Lox and Mouse TargetingAvailable SinceMarch 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7s-WPRE
Plasmid#104487PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, and AAV9InsertjGCaMP7s
UseAAVTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-mCherry-WT-KRAS-IRES-Blast
Plasmid#153335PurposeLentiviral vector plasmid for integration and constitutive expression of mCherry fused to wild-type KRAS in mammalian cellsDepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSF-MCM3/5
Plasmid#116950PurposeExpresses human MCM3 and human MCM5DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdest N-FLAG METTL1-WT puro
Plasmid#223055PurposeMETTL1-WT gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-CM Neo
Plasmid#223061PurposeMETTL1-CM gene expression in mammalian cellsDepositorInsertMETTL1-CM (METTL1 Human)
UseLentiviralExpressionMammalianMutation160-163 (LFPD>AFPA)PromoterCMVAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUltraHot-mCherry-DHX36-iso1-WT
Plasmid#206964Purposeexpressing the protein DHX36 fused to mCherry in human cellsDepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
VGAT scFv [L118/14]
Plasmid#206754PurposeMammalian Expression of VGAT scFV. Derived from hybridoma L118/14 scFv.DepositorAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7c variant 1513
Plasmid#105320PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7c variant 1513
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
Kv1.2 K+ channel scFv [K14/16]
Plasmid#182064PurposeMammalian Expression of Kv1.2 K+ channel scFv. Derived from hybridoma K14/16.DepositorInsertrecombinant mouse scFv targeting Kv1.2 K+ channel (Homo sapiens) (KCNA2 Mouse)
TagsHA, HisExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hGOLGA2-C-PEN2
Plasmid#183649PurposeLentiviral expression of a golgi-residential PEN2.DepositorAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Kv2.1 K+ channel scFv [K39/25]
Plasmid#182067PurposeMammalian Expression of Kv2.1 K+ channel scFv. Derived from hybridoma K39/25.DepositorInsertrecombinant mouse scFv targeting Kv2.1 K+ channel (Rattus norvegicus) (Kcnb1 Mouse)
TagsHA, HisExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha13-RLuc8
Plasmid#140986PurposeEncodes a G alpha subunit (GNA13) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha13-RLuc8 (GNA13 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
GAD67 scFv [L127/8]
Plasmid#190509PurposeMammalian Expression of GAD67 scFV. Derived from hybridoma L127/8.DepositorInsertGAD67 (Homo sapiens) recombinant scFV (GAD1 Mouse)
TagsSortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FlpO-bGHpA
Plasmid#51669PurposeCan be used to generate AAV virus that will express the FlpO recombinase gene in neurons from the synapsin promoter.DepositorHas ServiceAAV RetrogradeInsertFlpO recombinase gene
UseAAVExpressionMammalianPromoterhSyn1Available SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GABA(A)R, Alpha1 scFv [N95/35]
Plasmid#199430PurposeMammalian expression of GABA(A)R, Alpha1 scFv. Derived from hybridoma N95/35.DepositorInsertrecombinant mouse scFv targetingGABA(A)R, Alpha1 (Human) (GABRA1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Kv4.2 K+ channel (external) scFv [K57/41]
Plasmid#206771PurposeMammalian Expression of Kv4.2 K+ channel (external) scFV. Derived from hybridoma K57/41 scFv.DepositorInsertKv4.2 K+ channel (external) (Homo sapiens) recombinant scFV (KCND2 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Neurexin-1-Beta scFv [N170A/26]
Plasmid#199425PurposeMammalian expression of Neurexin-1-Beta scFv. Derived from hybridoma N170A/26.DepositorInsertrecombinant mouse scFv targeting Neurexin-1-Beta (Human) (NRXN1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
GABA(A)R, Gamma2L/S scFv [N452/73]
Plasmid#190555PurposeMammalian Expression of GABA(A)R, Gamma2L/S scFV. Derived from hybridoma N452/73.DepositorInsertGABA(A)R, Gamma2L/S (Homo sapiens) recombinant scFV (GABRG2 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD19-ST3-His_withSUMO
Plasmid#223219PurposeExpression of the extracellular domain of human CD19 fused to Spytag003 + Histag in HEK293(or similar) with SUMO for better protein expressionDepositorInsertextracellular domain of B-lymphocyte antigen CD19 (CD19 Human)
TagsHistag, SUMO, and SpytagExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDF-MCM4/6
Plasmid#116951PurposeExpresses human MCM4 and human MCM6DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRP4 (extracellular) scFv [N207/27]
Plasmid#190537PurposeMammalian Expression of LRP4 (extracellular) scFV. Derived from hybridoma N207/27.DepositorInsertLRP4 (extracellular) (Mus musculus) recombinant scFV (Lrp4 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19_mRuby-3xFLAG-NLS-3xSV40-poly(A)_loxP-PGK-Puro-loxP
Plasmid#195505PurposeT-REX17 donor plasmid to generate locus specific integration of mRuby followed by 3xSV40 poly(A) into Exon 1 of human lncRNA T-REX17DepositorInsertpT-REX-mRuby-3xFLAG-NLS-3xSV40-poly(A)_loxP-PGK-Puro-loxP_T-REX(Ex1)
UseCRISPR; Donor vectorTagsmRuby-3xFLAG-NLS-3xSV40-poly(A)ExpressionMammalianAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-GABA-A-R-Pi [N431/64R]
Plasmid#206576PurposeMammalian Expression Plasmid of anti-GABA-A-R-Pi (Human). Derived from hybridoma N431/64.DepositorInsertanti-GABA-A-R-Pi (Homo sapiens) recombinant Mouse monoclonal antibody (GABRP Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFAP scFv [N206A/8]
Plasmid#199426PurposeMammalian expression of GFAP scFv. Derived from hybridoma N206A/8.DepositorAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET32-MCM2/7
Plasmid#116949PurposeExpresses human MCM2 and human MCM7DepositorAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only