-
Plasmid#182122PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc AspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc AspCas12a
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorInsertPLK1 (PLK1 Human)
UseCRISPR and LentiviralTagsBFPExpressionMammalianMutationPromoterU6Available sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.S_mCherry-NLS
Plasmid#178276PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.Ollas_mCherry-NLS
Plasmid#178259PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.NWS_mCherry-NLS
Plasmid#178258PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.NWS and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; gcry1:BFP -0
Plasmid#173889PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; gcry1: BFP
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; gcry1:BFP -1
Plasmid#173890PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; gcry1: BFP
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria3
Plasmid#124869PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtTagsExpressionMammalianMutationPromoterCAG and U6Available sinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
AcrIIC1X* (AcrIIC1X-mCherry chimera)
Plasmid#128114PurposeExpresses AcrIIC1(N3F/D15Q/A48I) fused to mCherry; mediates potent inhibition of both, N. meningitidis as well as S. aureus Cas9DepositorInsertAcrX* (AcrIIC1 N3F/D15Q/A48I fused to mCherry)
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterEF1a and U6Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-EZR
Plasmid#227294PurposeDonor template for mStayGold insertion into the C-terminus of the EZR locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-EZR (Addgene #227293)DepositorInsertEZR Homology Arms flanking a mStayGold Tag (EZR Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H3C2
Plasmid#227334PurposeDonor template for mStayGold insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a mStayGold Tag (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H3C2
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CEP192
Plasmid#227289PurposeDonor template for mStayGold insertion into the C-terminus of the CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold Tag (CEP192 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhU6 and hU6-2xTetOAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-hsyn DIO GCaMP8f(with gRNA scaffold)
Plasmid#199580PurposeExpresses GCaMP8f in a Cre-dependent mannerDepositorInsertHis-DIO GCaMP8f
UseAAV, CRISPR, and Cre/LoxTags6xHisExpressionMammalianMutationPromoterhsynAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantMutationPromoterArabidopsis U6 promoterAvailable sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-FAM13A
Plasmid#185550PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting FAM13ADepositorInsertFAM13A gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA320
Plasmid#215952PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0 [EnAs]; sgCD47_v1 [EnAs]; DR_v1 [EnAs]; sgCD47_v2 [EnAs]}
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA435
Plasmid#215962PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; sgCD274_v1; DR_v1 [EnAs]; sgADGRE5_v3; DR_v2; sgCD4_v1; DR_v3; sgDPP4_v1
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA083
Plasmid#215934PurposeFragmid fragment: (guide cassette) reverse orientation; guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0 [EnAs]; sgCD4_v1 [EnAs]; DR_v1 [EnAs]; sgCD4_v2 [EnAs]}
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-Prf1-mock-ires-mCherry
Plasmid#209074PurposeTargeting vector for the mouse Prf1 locus to correct prf1 geneDepositorInsertPrf1-mock-ires-mCherry HDR template (parts of Prf1(S399Stop) with mutated PAM) (Prf1 Mouse)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-V5-APEX2 (in pLEX_307)
Plasmid#214921Purposeconstitutive expression of SRRD fused to V5 and APEX2 - used for APEX2 proximity biotinylationDepositorInsertSRRD (SRRD Human)
UseLentiviralTagsV5-APEX2ExpressionMutationPromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF90_5-5)-PGKpuroBFP-W
Plasmid#212003PurposeExpress gRNA against ZNF90 with puro and BFPDepositorInsertsgRNA targeting ZNF90 (ZNF90 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZIC2_5-4)-PGKpuroBFP-W
Plasmid#211994PurposeExpress gRNA against ZIC2 with puro and BFPDepositorInsertsgRNA targeting ZIC2 (ZIC2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZIC2_5-5)-PGKpuroBFP-W
Plasmid#211995PurposeExpress gRNA against ZIC2 with puro and BFPDepositorInsertsgRNA targeting ZIC2 (ZIC2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF398_5-2)-PGKpuroBFP-W
Plasmid#211998PurposeExpress gRNA against ZNF398 with puro and BFPDepositorInsertsgRNA targeting ZNF398 (ZNF398 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF398_5-5)-PGKpuroBFP-W
Plasmid#211999PurposeExpress gRNA against ZNF398 with puro and BFPDepositorInsertsgRNA targeting ZNF398 (ZNF398 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF649_5-1)-PGKpuroBFP-W
Plasmid#212000PurposeExpress gRNA against ZNF649 with puro and BFPDepositorInsertsgRNA targeting ZNF649 (ZNF649 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF649_5-5)-PGKpuroBFP-W
Plasmid#212001PurposeExpress gRNA against ZNF649 with puro and BFPDepositorInsertsgRNA targeting ZNF649 (ZNF649 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF90_5-3)-PGKpuroBFP-W
Plasmid#212002PurposeExpress gRNA against ZNF90 with puro and BFPDepositorInsertsgRNA targeting ZNF90 (ZNF90 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-4)-PGKpuroBFP-W
Plasmid#211992PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PRDM14_v32_7-4)-PGKpuroBFP-W
Plasmid#211982PurposeExpress gRNA against PRDM14 with puro and BFPDepositorInsertsgRNA targeting PRDM14 (PRDM14 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PRDM14_v32_7-6)-PGKpuroBFP-W
Plasmid#211983PurposeExpress gRNA against PRDM14 with puro and BFPDepositorInsertsgRNA targeting PRDM14 (PRDM14 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1-1)-PGKpuroBFP-W
Plasmid#211954PurposeExpress safe-cutter control gRNA with puro and BFPDepositorInsertsafe-cutter control sgRNA_AAVS1-1 (AAVS1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only