We narrowed to 24,790 results for: Spr
-
Plasmid#160140PurposeCMV and T7 promoter expression plasmid for human codon optimized AsCas12a with a c-terminal NLS(nucleoplasmin), 3x HA tag, and P2A-EGFPDepositorInserthuman codon optimized AsCas12a with NLS(nucleoplasmin)-3xHA-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsNLS(nucleoplasmin)-3xHA-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-Lambda2
Plasmid#104184PurposeLentiviral transfer vector that carries U6-driven non-targeting sgRNA using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-sgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin2a
Plasmid#124850PurposeMutagenesis of Grin2aDepositorInsertGrin2a (Grin2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MYO1C
Plasmid#227306PurposeDonor template for mStayGold insertion into the N-terminus of the MYO1C locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MYO1C (Addgene #227305)DepositorInsertMYO1C Homology Arms flanking a mStayGold Tag (MYO1C Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR
Plasmid#136514PurposeExpresses type II-A anti-CRISPR protein AcrIIA5 in mammalian cells in a lentiviral vectorDepositorInsertCodon-optimized AcrIIA5
UseLentiviralTagsFLAG/NLSExpressionMammalianPromoterSFFVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6
Plasmid#124860PurposeMutagenesis of Slc17a6DepositorInsertSlc17a6 (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hCjeCas9-NLS(SV40)-3xFLAG (KAC579)
Plasmid#133789PurposeCAG promoter expression plasmid for human codon optimized CjeCas9 nuclease with C-terminal NLS (SV40)DepositorInserthuman codon optimized CjeCas9
TagsNLS(SV40)-3xFLAGExpressionMammalianMutationn/aPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
TOP2A sgRNA1
Plasmid#138190Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TOP2A sgRNA2
Plasmid#138191Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-NL-DHFR-SpCas9
Plasmid#124522PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cellsDepositorInsertNL-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AA145
Plasmid#215937PurposeFragmid fragment: (guide cassette) guide expression; Chen F+E trRNA (preferred)DepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v1; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR-U6gRNA-PGKpuro2APDGFB
Plasmid#136409PurposeDonor vector for gRNA subcloning. Required for gRNA cloning into the RCAS-DV. Also constitutively expresses PDGFB.DepositorTypeEmpty backboneUseCRISPRMutationBbsI restriction site in the PDGFB sequence (Glu1…PromoterU6, PDKAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPPC011
Plasmid#171143PurposeExpression of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) on pRK2-KmR plasmidDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC620
Plasmid#62282PurposeExpresses dCas9, MCP-VP64, and PCP-VP64 in Yeast cellsDepositorInsertsMCP-VP64
PCP-VP64
dCas9
TagsVP64ExpressionYeastMutationNuclease activity has been inactivated by mutatio…PromoterpAdh and pTdh3Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAGT6471
Plasmid#219428PurposeModule of intronized NLS-SpCas9-NLS for N-terminal and C-terminal tag fusions (AGGT_N-SpCas9i-N_TTCG)DepositorInsertAGGT_NLS-SpCas9i-NLS(no stop)_TTCG
UseMoclo compatible level 0 moduleAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria2
Plasmid#124868PurposeMutagenesis of Gria2DepositorInsertGria2 (Gria2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-BE3∆UGI
Plasmid#96943PurposeThe plasmid encoding the His6-rAPOBEC1-XTEN-nCas9 protein (BE3∆UGI) was generated by site-directed mutagenesis using pET28b-BE1 (Addgene plasmid #73018).DepositorInsertBE3∆UGI
TagsHis6 tagExpressionBacterialPromoterT7Available SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.4RT4-Pct5.1-crRNA(cgr2)-RT(Δcgr12)
Plasmid#191650PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(cgr2-targeting spacer) cgr1/cgr2-deleting repair template, used for cgr1/cgr2 deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGW011b Dual AAV vector pAAV-EFS-dCAS9-spA
Plasmid#192160PurposeDual AAV vector AAV-dCas9DepositorInsertDead Cas9
UseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-hIP-dCas9-BSD
Plasmid#183231PurposeLentiviral vectors with the human insulin promoter driving expression of dCas9, in addition to a U6-driven sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralPromoterHuman insulin promoterAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGrin1
Plasmid#124865PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)
Plasmid#134331PurposeCAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tagDepositorInserthuman codon optimized Nme2Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK3258 - human expression plasmid for eSpCas9(1.1)
Plasmid#101176PurposeHuman expression plasmid for SpCas9 eSpCas9(1.1) variant: CMV-T7-hSpCas9-eSpCas9(1.1)(K848A, K1003A, R1060A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-eSpCas9(1.1)(K848A/K1003A/R1060A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationK848A/K1003A/R1060APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-CIB1-dCas9
Plasmid#63665PurposeMammalian gRNA expression vector also expressing CIB1-dCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJJGL004
Plasmid#180608PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-PlmCasX+Region1 insertionDepositorInsertPlmCasX with DpbCasX R1 loop
UseCRISPRTags10xHis and MBPExpressionBacterialPromoterT7Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
qTAG-C-mNeon-Blast-TUBB4B
Plasmid#207786PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the TUBB4B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBB4B Addgene #207785DepositorInsertTUBB4B Homology Arms flanking a mNeon-Blast Cassette (TUBB4B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti ABE7.10-N-AIDmax
Plasmid#157949PurposeLentiviral expression of ABE7.10-N-AIDmaxDepositorInsertLenti ABE7.10-N-AIDmax
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AA290
Plasmid#215949PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD55_v4; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA286
Plasmid#215948PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v6; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-gfap-sgRNA
Plasmid#65566Purposein vitro trancription of sgRNA targeting the zebrafish gfap locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7529 pHR (hU6-crLPT-EFS-PuroR-WPRE)
Plasmid#214877PurposeLentiviral vector encoding RfxCas13d targeting LPT guide arrayDepositorInserthU6-crLPT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KMT2B
Plasmid#101070PurposeDonor vector for 3' FLAG tag of human KMT2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR-U6gRNA-PGKpuro2ABFP
Plasmid#136405PurposeDonor vector for gRNA subcloning. Required for gRNA cloning into the RCAS-DV. Also constitutively expresses Puromycin linked to TagBFP.DepositorTypeEmpty backboneUseCRISPRMutationBbsI restriction site at position 437 was removed…PromoterU6, PDKAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_NFIA_iso1
Plasmid#104039PurposeDonor vector for 3' FLAG tag of human NFIA_iso1DepositorAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
2xNLS-NLP-cMyc LbaCas12a
Plasmid#182123PurposepET21a protein expression vector for 2xNLS-NLP-cMyc LbaCas12a in bacteriaDepositorInsert2xNLS-NLP-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PV225
Plasmid#132334PurposedCas9 plant transcriptional activator (AT-CBF1) linked constitutive expression cassette for Zea maysDepositorInsertdCas9-AT-CBF1 (CBF1 Cas9 (Streptococcus pyogenes); AT-CBF1 (Arabidopsis thaliana))
TagsAT-CBF1ExpressionPlantMutationCodon optimize for expression and stability in Ze…Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT
Plasmid#140201PurposeFungal vector for one-step cloning of LbCas12a crRNA arrays and expression. Pgpda and pyroA are BsmbI domesticated.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Cloning of crrna an…TagsdLbCas12a crRNA scaffoldPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only