We narrowed to 2,834 results for: GFP reporter gene
-
Plasmid#169316PurposeDoxycycline-inducible expression of miR-ctrl with dTomato as reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsdTomatoExpressionMutationPromoterTREAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-ctrl
Plasmid#169305PurposeConstitutive overexpression of miR-ctrl with GFP as a reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsEGFPExpressionMutationPromoterSFFVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-Thy1.2-P2A-GFP-T2A-Nef
Plasmid#126553PurposeReplication incompetent HIV with H13L Tat and GFP-t2a-Thy1.2 reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsThy1.2 and GFPExpressionMutationPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…TagsExpressionMammalianMutationPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Y203)
Plasmid#63559PurposeExpression of the Mostaza (yellow) spectral variant of eGFP in bacteria and in mammalian cells. Used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Y203)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged threonine at position 203 with respect to…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK074 p5E exorh:EGFP
Plasmid#195951PurposeGateway p5E vector with reporterDepositorInsertexorh:EGFP
UseOtherTagsExpressionMutationPromoterAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(H66)
Plasmid#63558PurposeExpression of the Azure (blue) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(H66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(W66)
Plasmid#63217PurposeExpression of the Celeste (cyan) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(W66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-NeoCOVGT3-d2EGFP
Plasmid#201446PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EOS-S(4+)-EGFP
Plasmid#21317PurposeLentiviral EOS reporter with Sox2 enhancer (x4), expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralTagsExpressionMammalianMutationPromoterEOS-S(4+) promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EOS-C(3+)-EGFP
Plasmid#21318PurposeLentiviral EOS reporter with Oct3/4 enhancer (x3), expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralTagsExpressionMammalianMutationPromoterEOS-C(3+) promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-QUAS5x:GFPNLS-SV40pA
Plasmid#155122PurposeTol2 vector containing QUAS5x reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUAS5x:GFPNLS
UseZebrafish expressionTagsExpressionMutationPromoterQUAS5x-E1bAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-EGFP
Plasmid#65282PurposeTNF reporter only (no hook) (RUSH system)DepositorInsertTNF (TNF Human)
UseLentiviralTagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMutationPromoterCMVAvailable SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
p1.1-Tr2-eGFP
Plasmid#162782PurposeFluorescent reporter for protein expression studiesDepositorInsertenhanced green fluorescent protein
UseTagsExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHBS1292 TDP43 RRM-GFP G368W+W385G
Plasmid#107838PurposeTo test the effect of sequence on TDP43 droplet propertiesDepositorInsertTARDBP mutant (TARDBP Human)
UseTagsExpressionMammalianMutationG368W and W385G mutations in LLPS reporterPromoterAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS315-ADH700p-yeCherry-p150-yeGFP-CYCt
Plasmid#194519PurposeDual fluorescence reporter for studying protein degradationDepositorInsertTIF4631 leader sequence
UseTagsExpressionYeastMutationPromoterAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG dCas9-KRAB-2A-EGFP
Plasmid#92396PurposeCAG-driven ubiquitous expression of catalytically inactive Cas9 fused to KRAB repressor domain. Contains 2A-EGFP reporter. For targeted enhancer inactivation in chicken embryos.DepositorInsertdCas9_KRAB_2A_EGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUGW-eGFP-ZEB1 3'UTR
Plasmid#81018PurposeFUGW lentiviral vector with constitutively expressed eGFP regulated by the human Zeb1 3'UTR. Brighter than destabilized d2GFP sensor reported in manuscriptDepositorAvailable SinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B WT
Plasmid#123114PurposeExpresses EGFP-LC3B wild-type in mammalian cells. Fluorescent reporter for autophagosomes.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xAARE-minP-EGFP
Plasmid#159666PurposeEGFP reporter plasmid containing 25 tandem repeats of the amino acid response element (AARE)DepositorInsert25xAARE-minP-EGFP
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xUPRE-minP-EGFP
Plasmid#159668PurposeEGFP reporter plasmid containing 25 tandem repeats of the the unfolded protein response element (UPRE)DepositorInsert25xUPRE-minP-EGFP
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EGFP-Bulged-miR-19
Plasmid#91976PurposeEGFP reporter cell line with eight bulged miR-19 sitesDepositorInsertEGFP
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xERSE2-minP-EGFP
Plasmid#159667PurposeEGFP reporter plasmid containing 25 tandem repeats of the ER stress response element-2 (ERSE2)DepositorInsert25xERSE2-minP-EGFP
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2 GFP-GSK3-MAPK
Plasmid#29689PurposeGFP reporter protein fused to three GSK3 phosphorylation sitesDepositorInsertGFP glycogen synthase kinase 3 recognition site primed by MAPK
UseTagsFlag and Flag-EGFPExpressionMammalianMutationrecognition sites only, and E3 ligase sitePromoterSP6Available SinceJuly 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2 GFP-GSK3mut-MAPK
Plasmid#29690PurposeGFP reporter protein fused to three mutated GSK3 phosphorylation sitesDepositorInsertGFP glycogen synthase kinase 3 recognition site mutated primed by MAPK
UseTagsFlag and Flag-EGFPExpressionMammalianMutationrecognition sites only, and E3 ligase site, GSK3 …PromoterSP6Available SinceJan. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MLC2(CA)-IRES-GFP
Plasmid#133928PurposeBicistronic vector for the expression of EGFP reporter and untagged constitutive active myosin II light chainDepositorInsertEGFP and MLC2(CA) (MYL2 Human)
UseTagsExpressionMammalianMutationMLC2 T18D, S19DPromoterAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xBstTyrT(CUA)_EF1 sfGFP150TAG
Plasmid#174891Purposeamber suppression reporter sfGFP150TAG expression, with BstTyr(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
UseTagsExpressionMammalianMutation150TAG in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10-VEGFprom(-1000 to -500)
Plasmid#66129PurposeLuciferase-based reporter for VEGF promoter region (-1000 to -500 bp)DepositorInsertVascular Endothelial Growth Factor -A promoter region (VEGFA Human)
UseLuciferaseTagsExpressionMutationPromoterVEGF -500 to -1Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
UseTagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianMutationPromoterChicken beta actin and Chicken beta actin (shared…Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10-VEGFprom(-950 to -700)
Plasmid#66133PurposeLuciferase-based reporter for VEGF promoter region (-950 to -700 bp)DepositorInsertVascular Endothelial Growth Factor-A promoter region (VEGFA Human)
UseLuciferaseTagsExpressionMutationPromoterVEGF -950 to -700Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-eGFP-KDEL
Plasmid#177728PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFlucDM
UseTagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)PromoterAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cux1-SE(HS)-eGFP-PGK-H2BRFP
Plasmid#241867PurposeHair shaft (HS)-specific Cux1 epicenter-driven fluorescent reporterDepositorInsertCux1-SE(HS)-eGFP
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
UseTagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGPromoterAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-eGFP-KDEL
Plasmid#177727PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFluc
UseTagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianMutationPromoterAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN-mD1R promoter-AcGFPnuc-WPRE
Plasmid#245087PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Mouse D1R promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianMutationPromoterMouse D1R promoterAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
4xnrUAS:MLS-KillerRed in pTol2pA2-acrys-EGFP-
Plasmid#115516PurposePlasmid driving expression of membrane bound KillerRed fluorophore under UAS response element, with a green lens reporterDepositorInsertMLS-KillerRed
UseGateway cloningTagsMLSExpressionMutationPromoterUASAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
phage ubc nls ha pcp gfp
Plasmid#64539PurposeUsed to label reporter mRNAs. Lentiviral expression of the PP7 coat protein fused to EGFP.DepositorInsertPCP
UseLentiviralTagsEGFP, FactorXa site, HA, and NLSExpressionMammalianMutationPromoterhuman ubiquitin C promoterAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSJ1679 (pRS315-NOP1pr-GFP11-PUS1)
Plasmid#86414Purposenuclear split GFP11 reporter without mCherryDepositorInsertNOP1pr-GFP11-PUS1
UseTagsGFP11 and mCherryExpressionYeastMutationPromoterNOP1prAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ GFP-2xESP3I-IRES-mCherry
Plasmid#230996PurposeProtein stability reporter construct for transient expression in mammalian cells. Stability of N-terminal GFP-fusion protein can be assessed by flow cytometry by normalizing to mCherry expression.DepositorTypeEmpty backboneUseTagsAcGFP1ExpressionMammalianMutationPromoterCMVAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-2xflox-BRX-eGFP-NLS
Plasmid#217535PurposeAAV vector to drive the expression of eGFP in genetically defined cell populations under the control of the 4xBRE regulatory element of SMAD1 transcription factor and miniXon splicing casette in vivoDepositorArticleInsert4X BRE reporter and miniXon casette (Smad1 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterBMP response element (BRE)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPH-T2A-GFP-shP53
Plasmid#102895PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPH-T2A-GFP-shP53
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mGFP-APEX2
Plasmid#171936PurposeReporter for correlated light and electron microscopy.DepositorInsertmGFP-APEX2
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterCAGAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
EW408 (ZNF35tar-compact)x8-H2B-GFP
Plasmid#236129PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF35 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
UseTagsEGFPExpressionMammalianMutationPromoterE1b minimal promoter with eight ZNF35 binding sit…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(335-406)-H2B-GFP
Plasmid#236151PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 335 to 406 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
UseTagsEGFPExpressionMammalianMutationPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pES006 (pTet-qacR 2/pQacA-deGFP)
Plasmid#69035Purposereporter with qacR 2 on single plasmidDepositorInsertsUseTagsHis6 tagExpressionBacterialMutationE57Q, E58L, W61Y, E90Q, I99Q, M116Q, L119Y, E120Q…PromoterpQacA and pTetAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pES007 (pTet-qacR 5/pQacA-deGFP)
Plasmid#69036Purposereporter with qacR 5 on single plasmidDepositorInsertsUseTagsHis6 tagExpressionBacterialMutationW61Y, E90Q, F102S, M116Q, Y119L, E120QPromoterpQacA and pTetAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ control UTRs
Plasmid#67929PurposeTranslational reporter - control UTRsDepositorInsertsfGFP-NLS-P2A-NLS-mCherry
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ Emi1 5' and 3'UTR
Plasmid#67930PurposeTranslational reporter - Emi1 UTRsDepositorInsertsfGFP-NLS-P2A-NLS-mCherry
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.ARID3a.IRES.GFP
Plasmid#169300PurposeConstitutive overexpression of human ARID3A cDNA with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only