-
Plasmid#179445PurposeDonor vector to knock in Halotag C-terminal to human CRY1 geneDepositorInsertHaloTag (Halo7 Synthetic)
UseCRISPRTagsHis/FlagExpressionMutationPromoterNoneAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCC_06 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dCas9NG-NLS-VPR-2A-Puro-WPRE
Plasmid#139091PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdSpCas9-NG-VPR
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…PromoterAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRGEN-CMV-VPR-WT CjCas9 V-WT
Plasmid#169914PurposeExpression of VPR-WT CjCas9 fusion protein to induce orthogonal genes knock out and activation.DepositorInsertCjCas9
UseCRISPRTags2xSV40NLS, SV40NLS-HA, and VPR (VP64-p65-Rta)ExpressionMammalianMutationPromoterCMVAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1
Plasmid#101177PurposeHuman expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A)
UseTags3x FLAG and NLS (SV40)ExpressionMammalianMutationN497A/R661A/Q695A/K848A/Q926A/K1003A/R1060APromoterCMVAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG
Plasmid#179081PurposeAll-in-one prime editor piggyBac transposon, SpG variantDepositorInsertSpCas9 SpG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135L, S1136W, G1218K, E1219Q, R1335Q, T1337RPromoterCAGAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-TGFB2
Plasmid#185556PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting TGFB2DepositorInsertTGFB2 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJSC282 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variant
Plasmid#101231PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variantDepositorInsertSpCas9 variant C80S/C574S/S701C/S960C/N692A/M694A/Q695A/H698A
UseTags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S701C, S960C, N692A, M694A, Q695A an…PromoterT7Available sinceNov. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-MFAP2
Plasmid#185555PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting MFAP2DepositorInsertMFAP2 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-SOX4
Plasmid#185552PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting SOX4DepositorInsertSOX4 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-Halo-CD4-bla
Plasmid#179451PurposeDonor vector to knock in Halotag C-terminal to human PER2 geneDepositorInsertHaloTag (Halo7 Synthetic)
UseCRISPRTagsHis/FlagExpressionMutationPromoterNoneAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE4566
Plasmid#88904PurposeExpresses MbCpf1 crRNA and inactive/dead, humanized MbCpf1 nucleaseDepositorInsertsMb crRNA
hMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMV and human U6Available sinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCC_10 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dCas9NG-NLS-2A-Puro-WPRE
Plasmid#139095PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9-NG
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…PromoterAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-Luciferase-hvTK-bla
Plasmid#179444PurposeDonor vector to knock in firefly Luciferase C-terminal to human CRY1 geneDepositorInsertLuciferase
UseCRISPRTagsHis/FlagExpressionMutationPromoterNoneAvailable sinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_UCOE-SFFV-dCas9-XTEN80-KRAB(Kox1)-IRES-mCherry
Plasmid#188770PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)ExpressionMutationPromoterSFFVAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-PE NG
Plasmid#174554PurposeAll-in-one prime editor piggyBac transposon, NG variantDepositorInsertSpCas9 NG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationL1111R, G1218R, E1219F, A1322R, R1335V, T1337RPromoterCAGAvailable sinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3F2-mCherry
Plasmid#73418PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3F2.DepositorInsertPromoter 3F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP3F2 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorInserthSpCas9 (Otx2 S. pyogenes, Mouse)
UseCRISPRTagsExpressionMutationPromoterEf1aAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR1
Plasmid#176244PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterRibosomal subunitAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT7-5)-PGKpuro2ABFP-W
Plasmid#159287PurposeLentiviral vector expressing gRNA targeting KAT7 (gRNA ID. 5)DepositorInsertguide RNA targeting KAT7 (ID. 5) (KAT7 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6 promoterAvailable sinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3A2-mCherry
Plasmid#73425PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.DepositorInsertPromoter 3A2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP3A2 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC120 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant
Plasmid#101208PurposeBacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A
UseTags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N497A, R661A and Q695APromoterT7Available sinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-5F5-mCherry
Plasmid#73422PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 5F5.DepositorInsertPromoter 5F5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterP5F5 (orthogonal T7-lac variant)Available sinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC011 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variant
Plasmid#101229PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N692A/M694A/Q695A/H698A
UseTags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N692A, M694A, Q695A an…PromoterT7Available sinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-LMNB1
Plasmid#227328PurposeDonor template for mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a mStayGold Tag (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-KO-Puro-TP53
Plasmid#227319PurposeDonor template for 2A-Puro insertion into the N-terminus of the TP53 locus. For selectable p53 knock-out. To be co-transfected with sgRNA plasmid px330-TP53 (Addgene #227318)DepositorInsertTP53 Homology Arms flanking a 2A-Puro Cassette (TP53 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Blast-ARL13B
Plasmid#227278PurposeDonor template for mStayGold-EFS-Blast insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold-EFS-Blast Cassette (ARL13B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-ACTB
Plasmid#227326PurposeDonor template for mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorInsertACTB Homology Arms flanking a mStayGold Tag (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CEP135
Plasmid#227287PurposeDonor template for mStayGold insertion into the N-terminus of the CEP135 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CEP135 (Addgene #227286)DepositorInsertCEP135 Homology Arms flanking a mStayGold Tag (CEP135 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-ARL13B
Plasmid#227277PurposeDonor template for mStayGold insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with sgRNA plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold Tag (ARL13B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-CEP192
Plasmid#227290PurposeDonor template for mStayGold-EFS-Puro insertion into the C-term of CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold-EFS-Puro Cassette (CEP192 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_TELO2_gRNA
Plasmid#224379PurposeTargets TELO2 for dTAG N terminal knock-in cell linesDepositorInsertTELO2 (TELO2 Human)
UseCRISPRTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_GNB1L_gRNA
Plasmid#224377PurposeTargets GNB1L for dTAG C terminal knock-in cell linesDepositorInsertGNB1L (GNB1L Human)
UseCRISPRTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEcNucC
Plasmid#214050PurposeBacterial expression plasmid for E. coli MS 115-1 NucC, a cA3-responsive nuclease known to cause abortive infection; used as a positive control in the Haliangium ochraceum type III CRISPR-Cas systemDepositorInsertEcNucC
UseTagsExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA324
Plasmid#215953PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0[EnAs]; sgCD46_v4[EnAs]; DR_v1[EnAs]; sgCD47_v2[EnAs]; DR_v2[EnAs]; sgCD55_v4[EnAs];DR_v3[EnAs];sgCD81_v4[EnAs]}
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-moxGFP-LMNB1
Plasmid#207772PurposeDonor template for Blast-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(ZIC3_5-3)-PGKpuroBFP-W
Plasmid#211996PurposeExpress gRNA against ZIC3 with puro and BFPDepositorInsertsgRNA targeting ZIC3 (ZIC3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZIC3_5-5)-PGKpuroBFP-W
Plasmid#211997PurposeExpress gRNA against ZIC3 with puro and BFPDepositorInsertsgRNA targeting ZIC3 (ZIC3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TRIM24_4)-PGKpuroBFP-W
Plasmid#211988PurposeExpress gRNA against TRIM24 with puro and BFPDepositorInsertsgRNA targeting TRIM24 (TRIM24 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TRIM24_5-4)-PGKpuroBFP-W
Plasmid#211989PurposeExpress gRNA against TRIM24 with puro and BFPDepositorInsertsgRNA targeting TRIM24 (TRIM24 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only