170,794 results
-
Plasmid#101124PurposeExpression of SNAP-tagged Histone H2B in mammalian cellsDepositorInserthistone cluster 1 H2B family member j (H2BC11 Human)
TagsSNAP-tag (SNAPf)ExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3 deltaN89 Beta-catenin
Plasmid#19288DepositorInsertbeta-catenin (CTNNB1 Human)
TagsFlagExpressionMammalianMutationN-terminal truncation, deleted aa 1-89Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSFS2A-CaHygB
Plasmid#189564PurposeCaHygB hygromycin resistance gene in the pSFS2A flipper backbone for genetic manipulation of Candida albicansDepositorInsertHygB
ExpressionYeastAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBT2-4xUAS:NICD-P2A-mRFP
Plasmid#127594PurposeZebrafish NICD was driven by 4xnrUAS, to be co-expressed with mRFP through P2A self-cleaving peptides.DepositorInsertNICD (notch1a Zebrafish)
UseZebrafish expressionAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5 BMPS N143S-6xHis
Plasmid#208891PurposeMammalian expression of recombinant BMPS N143SDepositorAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAST-pHuji-GINKO2
Plasmid#177117PurposeGenetically encoded green fluorescent potassium ion indicator GINKO2 and red fluorescent pH indicator pHuji fusionDepositorInsertpHuji-GINKO2
ExpressionInsectPromoterhsp70 promoterAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-dCas9-BE4max
Plasmid#216731PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and dCas9 (Cas9 with D10A and H840A mutations) in mammalian cells.DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-opto-hCaspase-1
Plasmid#208790PurposeInducibly expresses human Caspase1, fused to light-activatable Cry2DepositorAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
CD34-bio-His
Plasmid#51647PurposeExpresses full-length Hematopoietic progenitor cell antigen CD34 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertCD34 (CD34 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
HRV-3C Protease-mCherry
Plasmid#243792PurposeEncodes for mammalian expression of HRV-3C protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertHRV-3C protease
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
h-beta-ENaC
Plasmid#83429Purposefull length human beta ENaC with V5 tagDepositorAvailable SinceNov. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p5E-QUAS (L4-R1)
Plasmid#61374Purpose5' Gateway Entry Vector Containing QUASDepositorInsertQUAS
Available SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AAV2cap
Plasmid#198014PurposeFor high-level expression of the AAV2 cap gene, suitable for use with pCMV-Rep78/68 SSM libraryDepositorInsertAAV2 cap
UseAAVExpressionMammalianMutationWTPromoterCMVAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-NeuroD1iresGFP
Plasmid#45025DepositorAvailable SinceMay 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_VNp15-mNeongreen
Plasmid#182389PurposeBacterial expression of Vesicle Nucleating peptide15-mNeongreen fusionDepositorInsertVNp15-mNeongreen-His
TagsVesicle Nucleating peptide (VNp)ExpressionBacterialPromoterT7Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-p48
Plasmid#11614DepositorAvailable SinceJuly 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS
Plasmid#158058PurposeDonor plasmid for chromosomal integrations of any sequence at a locus downstream of the glmS gene in Enterobacteriaceae using kanamycin resistance as a selectable markerDepositorInsertsglmS homologous region 1
glmS homologous region 2 + MCS3
UseSynthetic BiologyAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTetOne-tdTomato-cNLS
Plasmid#138529PurposeInducible expression of tdTomato with nuclear localization signalDepositorInserttdTomato
Tags3x SV40 cNLSExpressionMammalianPromoterTRE3GsAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
p31sheLL
Plasmid#37322DepositorInsertHPV31L1+L2
ExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60226PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
TFORF2246
Plasmid#141989PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-CRISPR
Plasmid#85402PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expressionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pD864-LacZ
Plasmid#109380PurposeRhamnose inducible LacZ expression. Used to test burden response in E. coliDepositorInsertpRHAM-LacZ
ExpressionBacterialAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS316-RGR-GFP
Plasmid#51056PurposeExpress self-cleaving-ribozyme-flanked sgRNA cassette (RGR) targeting GFP for CRISPR systems in yeast driven by ADH1 promoter. RGR has a HH ribozyme at its 5', and an HDV ribozyme at its 3'.DepositorInsertRGR-GFP
UseCRISPRExpressionBacterial and YeastPromoterYeast ADH1 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-APOBEC1-YTH
Plasmid#178949PurposeLentiviral vector for dox-inducible expression of APOBEC1-YTH in mammalian cellsDepositorInsertAPOBEC1-YTH-T2A-GFP
UseLentiviral and Synthetic Biology; InducibleTagsHAExpressionMammalianPromotertight TREAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
mApple-hCOL1A1
Plasmid#140113PurposeExpresses fluorescently-tagged human Type I procollagen α1 chain with mApple replacing exon 2-3 retaining N-propeptide minor triple helix and N-terminal cleavage siteDepositorInsertType I procollagen α1 (COL1A1 Human)
TagsmAppleExpressionMammalianMutationCOL1A1 exons 2-3 replaced by fluorescent tagPromoterCMVAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-p27 T187A Luc
Plasmid#23048DepositorInsertp27 (CDKN1B Human)
TagsLuciferaseExpressionMammalianMutationT187A: mutation at codon 187 changing from T (ACG…Available SinceJan. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTS395_PhCMV-SB100
Plasmid#169633PurposeExpression vector encoding PhCMV driven SB100 sleeping beauty transposase (PhCMV-SB100-pA)DepositorInsertPCMV-driven SB100
ExpressionMammalianPromoterPhCMVAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLGB13
Plasmid#126618PurposeSuicide vector for allelic replacement in Bacteroides, erythromycin selection and aTC-inducible ss-Bfe1 counterselectionDepositorTypeEmpty backboneUseAllellic exchange in bacteriaAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.sgRNA.EFS.tRFP657
Plasmid#57824PurposeLentiviral Vector for Sp sgRNA delivery without SpCas9, tagRFP657, EFS Promoter drivenDepositorInsertssgRNA
EFS
tagRFP657
UseCRISPR and LentiviralAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRK5-FLAG-SLC38A9.1
Plasmid#71855PurposeoverexpressionDepositorInsertSLC38A9.1 (SLC38A9 Human)
TagsFLAGExpressionMammalianMutationcodon optimizedPromoterCMVAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Pb-TRE3G-TYR-HygR
Plasmid#195508Purposeinducible Piggybac vector expressing human TYR CDS with hygromycin selectionDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-N_WDR62:1-1518
Plasmid#211257PurposeMammalian expression of full-length human WDR62 isoform 4. N-terminal HiBiT tag.DepositorInsertWDR62:M1-H1518 (WDR62 Human)
TagsMVSGWRLFKKISGSSGGSSGExpressionMammalianMutationisoform 4. L850S natural VAR_031299. Q1305L n…PromoterCMVAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-HsProm1s1-mScarlet
Plasmid#211330PurposeMammalian overexpression vector for C-terminally mScarlet tagged human Prom1s1 (WT)DepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG -IRES-GFP
Plasmid#69047PurposeLentiviral backbone for GFP coexpressionDepositorTypeEmpty backboneUseLentiviralTagsIRES-GFPExpressionMammalianAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Puro-ARHGAP26
Plasmid#69467PurposeExpresses ARHGAP26DepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-Tol2
Plasmid#31831DepositorInsertTol2 Transposase
UseCloning vectorPromoterLacAvailable SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAM5411
Plasmid#132663PurposeRSF1010-based broad host-range plasmid with RK2 bom site and pUC origin expressing YFP and Sp/Sm resistanceDepositorInsertsaadA
YFP
ExpressionBacterialPromoterPaadA and PconIIAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only