We narrowed to 24,790 results for: Spr
-
Plasmid#67977PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mCherry markersDepositorInsertU6gRNA cassette, PGKpuro2AmCherry cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2AGFP-W
Plasmid#67981PurposeCas9 activity reporter (control) with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-Tet1v4-dCas9
Plasmid#232180PurposeTet1v4-dCas9 from Nuñez et al. 2021, in a lentiviral cassette with blasticidin resistance, for expression in mammalian cellsDepositorInsertTet1 catalytic domain - XTEN80 linker - dead Cas9 - 2A - BlastR (TET1 S. pyogenes, Human)
UseLentiviralTagsFLAGExpressionMammalianMutationD10A, H840APromoterhUbCAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-KRAB(Kox1)-MeCP2-P2A-EGFP
Plasmid#188902PurposedCas9 with a C-term NLS-KRAB(Kox1)-MeCP2 fusion (no linker), and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9-KRAB(Kox1)-MeCP2
UseLentiviralTagsNLS-KRAB(Kox1)-MeCP2 fusion (no linker) and P2A-G…PromoterSFFVAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-enAsCas12a(E174R/S542R/K548R)-NLS(nuc)-3xHA (AAS848)
Plasmid#107941PurposeMammalian expression plasmid for human codon optimized enAsCas12a (enhanced AsCas12a) encoding E174R/S542R/K548R substitutionsDepositorInserthuman codon optimized enAsCas12a (E174R/S542R/K548R)
Tags3x HA and NLS (nucleoplasmin)ExpressionMammalianMutationE174R, S542R and K548RPromoterCAGAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-dgRNA-CAG-MPH
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
Plasmid#71707PurposeA human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmidDepositorInserthumanized S. pyogenes Cas9 fused to human Geminin (GMNN Human)
UseCRISPRTags3xFLAG and hGEM(1/110)ExpressionMammalianPromoterCBhAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-LoxpStopLoxp-NLS-dCas9-HA-NLS-NLS-10xGCN4-NLS-P2A-scFv-NLS-P65-HSF1-Flag-T2A-EGFP-WPRE-PolyA
Plasmid#107307PurposeEncoding an SPH activation systemDepositorInsertCAG-LSL-dCas9-10xGCN4-P2A-scFv-P65-HSF1-T2A-EGFP-WPRE-PolyA
ExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGJK_His-SUMO-LbuCas13a
Plasmid#172488PurposeBacterial expression of codon-optimized His-SUMO-LbuCas13a.DepositorInsertbdSUMO-LbuCas13a (codon-optimized)
TagsHis6 and bdSUMOExpressionBacterialPromoterT7 promoter and lac operatorAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-bLbCas12a-NLS(nucleoplasmin)-6xHis (RTW645)
Plasmid#114070PurposeT7 promoter bacterial expression plasmid for bacterial codon optimized LbCas12a with C-terminal NLS and His-tagDepositorInsertbacteria codon optimized LbCas12a with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-Tet1c-dCas9
Plasmid#232178PurposeLentiviral cassette that expresses Tet1c-dCas9 fusion with a short linker in mammalian cellsDepositorInsertTet1 catalytic domain - dead Cas9 - 2A - BlastR (TET1 S. pyogenes, Human)
UseLentiviralTagsFLAGExpressionMammalianMutationD10A, H840APromoterhUbCAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1096 Dual-sgRNA.Design 1
Plasmid#159538PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 nuclease with two guide RNA cassettes with promoters
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmAG-W
Plasmid#67976PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mAG markersDepositorInsertU6gRNA cassette, PGKpuro2AmAG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
px552-U6-gRNA1-U6-gRNA2-CMV-eGFP
Plasmid#211760PurposePaired gRNAs (sgRNA1 and 2) targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.DepositorInsertgRNA1 and gRNA2 targeting VEGF-A (VEGFA Human, M. mulatta (rhesus macaque), Mouse)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Neurog2 x2)
Plasmid#171100PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Neurog2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1080 - prRosa26v2 LSL FLAG-SpCas9
Plasmid#113163PurposeA donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9DepositorInsertSpCas9
UseCRISPRTagsFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
Plasmid#154430Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vectorDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
UseAAV and CRISPRExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
Plasmid#67975PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markersDepositorInsertU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rAPOBEC1-gs-XTEN-gs-hdLbCas12a(D832A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(LbBE1.1) (RTW1295)
Plasmid#114085PurposeCAG promoter expression plasmid for human codon optimized LbBE1.1DepositorInserthuman codon optimized DNase-inactive (D832A) LbCas12a fused to N-terminal rAPOBEC1 and C-terminal UGI (LbBE1.1)
TagsSV40 NLSExpressionMammalianMutationD832AAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgTP53(R273)
Plasmid#85561PurposeExpresses sgRNA targeting human TP53 around codon R273DepositorInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A)-P2A-EGFP (pJUL1085)
Plasmid#123614PurposeCAG promoter expression plasmid for rAPOBEC1(R33A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A).DepositorInsertBE3(R33A)-P2A-EGFP
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-4)-PGKpuroBFP-W
Plasmid#211969PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-3)-PGKpuroBFP-W
Plasmid#211968PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-NLS(nucleoplasmin)-6xHis (BPK3541)
Plasmid#114069PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1124 - pAAV MeCP2 SpCas9(D10A)
Plasmid#112719PurposeAn AAV vector that expresses SpCas9 nickase under a neuronal cell promoterDepositorInsertSpCas9
UseAAVMutationD10APromoterMecp2Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-hAsCas12a-enRR(E174R/S542R/K607R)-NLS(nucleoplasmin)-3xHA (AAS1077)
Plasmid#114095PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-enRR(E174R/S542R/K607R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a-RR (E174R/S542R/K607R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationE174R, S542R and K607RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-NLS(SV40)x2-rAPOBEC1-gs-XTEN-gs-hdLbCas12a(D832A)-gs-UGI-NLS(SV40)(LbBE1.4) (RTW1293)
Plasmid#114086PurposeCAG promoter expression plasmid for human codon optimized LbBE1.4DepositorInserthuman codon optimized DNase-inactive (D832A) LbCas12a fused to N-terminal rAPOBEC1 and C-terminal UGI (LbBE1.4)
Tags2x SV40 NLS and SV40 NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(JARID2_5-4)-PGKpuroBFP-W
Plasmid#211966PurposeExpress gRNA against JARID2 with puro and BFPDepositorInsertsgRNA targeting JARID2 (JARID2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-SID4x-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188901PurposedCas9 with an N-term Sid4x fusion, a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertSID-dCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, P2A-GF…PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Dicot Edit E1_NTERM (GB2245)
Plasmid#160567PurposetRNA and scaffold for the assembly of GBoligomers for position [D1_n] of a monocistronic tRNA-gRNADepositorInsertMultiplexing Dicot Edit E1_NTERM (Multiplexing Dicot Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherry
Plasmid#135014PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the C-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-(Spyo_Cas9)-6xHis-NLS(SV40)
Plasmid#185706PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(Spyo_Cas9) with an N-terminal NLS and C-terminal NLSDepositorInsertCas9
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEPT_Cdk2-T160A-siR
Plasmid#73975PurposeHDR template to generate Cdk2-T160A-siRDepositorUseAAVMutationT160 mutated to Ala and siRNA target site mutatedAvailable SinceMarch 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a-RR(S542R/K607R)-NLS(nucleoplasmin)-3xHA (AAS1081)
Plasmid#114094PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-RR(S542R/K607R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a-RR (S542R/K607R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationS542R and K607RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2AmCherry-W
Plasmid#163177PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only