We narrowed to 24,939 results for: SPR
-
Plasmid#124868PurposeMutagenesis of Gria2DepositorInsertGria2 (Gria2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGW011b Dual AAV vector pAAV-EFS-dCAS9-spA
Plasmid#192160PurposeDual AAV vector AAV-dCas9DepositorInsertDead Cas9
UseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.4RT4-Pct5.1-crRNA(cgr2)-RT(Δcgr12)
Plasmid#191650PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(cgr2-targeting spacer) cgr1/cgr2-deleting repair template, used for cgr1/cgr2 deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-hIP-dCas9-BSD
Plasmid#183231PurposeLentiviral vectors with the human insulin promoter driving expression of dCas9, in addition to a U6-driven sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralPromoterHuman insulin promoterAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGrin1
Plasmid#124865PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)
Plasmid#134331PurposeCAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tagDepositorInserthuman codon optimized Nme2Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK3258 - human expression plasmid for eSpCas9(1.1)
Plasmid#101176PurposeHuman expression plasmid for SpCas9 eSpCas9(1.1) variant: CMV-T7-hSpCas9-eSpCas9(1.1)(K848A, K1003A, R1060A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-eSpCas9(1.1)(K848A/K1003A/R1060A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationK848A/K1003A/R1060APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-CIB1-dCas9
Plasmid#63665PurposeMammalian gRNA expression vector also expressing CIB1-dCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJJGL004
Plasmid#180608PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-PlmCasX+Region1 insertionDepositorInsertPlmCasX with DpbCasX R1 loop
UseCRISPRTags10xHis and MBPExpressionBacterialPromoterT7Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
Lenti ABE7.10-N-AIDmax
Plasmid#157949PurposeLentiviral expression of ABE7.10-N-AIDmaxDepositorInsertLenti ABE7.10-N-AIDmax
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Blast-TUBB4B
Plasmid#207786PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the TUBB4B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBB4B Addgene #207785DepositorInsertTUBB4B Homology Arms flanking a mNeon-Blast Cassette (TUBB4B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
AA290
Plasmid#215949PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD55_v4; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA286
Plasmid#215948PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v6; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-gfap-sgRNA
Plasmid#65566Purposein vitro trancription of sgRNA targeting the zebrafish gfap locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KMT2B
Plasmid#101070PurposeDonor vector for 3' FLAG tag of human KMT2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7529 pHR (hU6-crLPT-EFS-PuroR-WPRE)
Plasmid#214877PurposeLentiviral vector encoding RfxCas13d targeting LPT guide arrayDepositorInserthU6-crLPT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR-U6gRNA-PGKpuro2ABFP
Plasmid#136405PurposeDonor vector for gRNA subcloning. Required for gRNA cloning into the RCAS-DV. Also constitutively expresses Puromycin linked to TagBFP.DepositorTypeEmpty backboneUseCRISPRMutationBbsI restriction site at position 437 was removed…PromoterU6, PDKAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_NFIA_iso1
Plasmid#104039PurposeDonor vector for 3' FLAG tag of human NFIA_iso1DepositorAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
2xNLS-NLP-cMyc LbaCas12a
Plasmid#182123PurposepET21a protein expression vector for 2xNLS-NLP-cMyc LbaCas12a in bacteriaDepositorInsert2xNLS-NLP-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PV225
Plasmid#132334PurposedCas9 plant transcriptional activator (AT-CBF1) linked constitutive expression cassette for Zea maysDepositorInsertdCas9-AT-CBF1 (CBF1 Cas9 (Streptococcus pyogenes); AT-CBF1 (Arabidopsis thaliana))
TagsAT-CBF1ExpressionPlantMutationCodon optimize for expression and stability in Ze…Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT
Plasmid#140201PurposeFungal vector for one-step cloning of LbCas12a crRNA arrays and expression. Pgpda and pyroA are BsmbI domesticated.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Cloning of crrna an…TagsdLbCas12a crRNA scaffoldPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA1
Plasmid#138182Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA2
Plasmid#138183Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
(517) SB KRAB-SadCas9 U6-gStop
Plasmid#163023PurposeSleeping Beauty TET-On expression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTet-OnAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg1
Plasmid#124856PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCK669
Plasmid#192638PurposeExpresses dxCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dxCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dxCas9-NG h…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only