We narrowed to 15,366 results for: GRN
-
Plasmid#103022Purposeexpression of a Cpf1 programming crRNA targetting CAN1 (crCAN1-4S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only
-
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-sh4EBP2
Plasmid#81121Purposeexpresses an shRNA targeting murine 4E-BP2DepositorInsert4E-BP2 shRNA (Eif4ebp2 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA1
Plasmid#59303PurposeKnockdown of human FOXH1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Neo-TGmiR-Gb2
Plasmid#25746PurposeControl lentiviral vector with Tet-based inducible expression of mouse G beta 2 miR30-based shRNA and GFP, constitutive Neomycin resistance gene coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EFS-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188771PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterEFSAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX311-SHOC2-V5
Plasmid#134521PurposeLentiviral plasmid expressing SHOC2 with V5 C-term tagDepositorInsertSHOC2 (SHOC2 Human)
UseLentiviralTagsV5ExpressionMammalianMutationSilent mutations made at wobble base position at …PromoterEF1alphaAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGAC
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2res
Plasmid#106301PurposeExpresses SHMT2DepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationSilent mutations destroy sgRNA targeting sitesAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ANLN
Plasmid#183834PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertANLN homology arms with mNeonGreen-linker (ANLN Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-SID4x-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188901PurposedCas9 with an N-term Sid4x fusion, a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertSID-dCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, P2A-GF…PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2804 pHR: U6-SpsgTRE3G CMV-PYL1-VPR-IRES-mCherry
Plasmid#84258PurposeExpresses Sp sgTRE3G gRNA with ABA-inducible VPR and mCherry for OR gateDepositorInsertsSp sgTRE3G
PYL1-VPR
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
Plasmid#84260PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulationDepositorInsertsSp sgSV40
PYL1-KRAB
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ENL)
Plasmid#69212PurposeLentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; MLL-ENL,(t[11;19])DepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-CACNG3
Plasmid#140590PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA CACNG3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1.530
Plasmid#205441PurposeLevel 1 Position 1 pUC19 vector with sgRNA and GmR. Used for homologous recombination with Cas12a editing vector pC1.509. sgRNA targets pC1.509 for removal.DepositorInsertRepB gRNA
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gCAG
Plasmid#114384PurposepPN10 with gRNA for spCRISPR-Cas9 targeted to CAG repeat, PAM: CAGDepositorInsertgCAG
UseCRISPRAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK473
Plasmid#114715PurposesgRNA for LGN's N-terminal locusDepositorInsertLGN sgRNA
Available SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT062d
Plasmid#107911PurposeW2m.2-4 plasmid. Contains H1-TetR-sgRNA B and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertH1-TetR-sgRNA B
ExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT062e
Plasmid#107910PurposeW2m.2-3 plasmid. Contains U6-LacI-sgRNA A and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-LacI-sgRNA A
ExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBHM2644
Plasmid#229528PurposeCarries AID* tag, empty sgRNA, and NATR markerDepositorInsertAID* - empty sgRNA - NATR
Tags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
OA-1053B
Plasmid#184007PurposeExpresses arrays of gRNA targeting hh promoter under U6b/c promoterDepositorInsertU6b:sgRNAhh1 - U6c:sgRNAhh2
ExpressionInsectAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB1084
Plasmid#71516PurposeExpresses gRNA for dpy-10 conversion using NGCG PAM and VRER Cas9 mutantDepositorInsertdpy-10 gRNA
UseCRISPRExpressionWormPromoterU6Available SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJMP1067
Plasmid#119243Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWT050a
Plasmid#107899PurposeW2.4-2 plasmid. Contains PLacO-sgRNA1, PRha-sgRNA4 and is part of CAMERA 2.4DepositorInsertPLacO-sgRNA1, PRha-sgRNA4
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p7SK ST
Plasmid#188714PurposesgRNA plasmid encoding 7SK promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSOX11.1.0-gDNA
Plasmid#176378PurposeExpresses spCas9 and gRNA sequence targeting SOX11DepositorInsertSOX11 gRNA
UseCRISPRAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBACH2.2.0-gDNA
Plasmid#176375PurposeExpresses spCas9 and gRNA sequence targeting BACH2DepositorInsertBACH2 gRNA
UseCRISPRAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP2754
Plasmid#160666PurposeMobile CRISPRi sfGFP 'test', empty sgRNADepositorInsertempty sgRNA (BsaI)
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMM100
Plasmid#127225PurposeAtU6::sgRNA targeting PDSDepositorInsertsgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1104
Plasmid#119248Purposeknockdown pqsC in P. aeruginosaDepositorInsertsgRNA pqsC (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1102
Plasmid#119246Purposeknockdown phzA1 in P. aeruginosaDepositorInsertsgRNA phzA1 (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1103
Plasmid#119247Purposeknockdown phzM in P. aeruginosaDepositorInsertsgRNA phzM (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP2836
Plasmid#160674PurposeMobile CRISPRi sfGFP 'test', gmc6 sgRNADepositorInsertgmc6 (gfp) sgRNA
ExpressionBacterialAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP1341
Plasmid#119272Purposecontrol sgRNA in cells lacking rfpDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC016-gPsp-Control
Plasmid#233611PurposeExpression of guide RNA for PspCas13bDepositorInsertControl gRNA
UseCRISPRAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWT055h
Plasmid#96867PurposesgRNA-HEK4DepositorInsertsgRNA-HEK4
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-AtU6-HV5
Plasmid#239470PurposeEncodes a gRNA expression cassette driven by the AtU6 promoter.DepositorInsertU6-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC016-gPsp-EGFP_start_codon
Plasmid#233613PurposeExpression of guide RNA targeting the start codon of the EGFP gene for PspCas13bDepositorInsertgRNA targeting EGFP
UseCRISPRAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB8622
Plasmid#126912PurposePlasmid containing gRNA expression cassette targeting ADE2 in Saccharomyces cerevisiaeDepositorInsertADE2 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only