175,750 results
-
Plasmid#47684PurposeNotch reporterDepositorInsertTP-1 promoter
UseNotch reporter constructTagsd1EGFPMutationhexamerized 50-bp EBNA2 response element of the T…PromoterNAAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pXPR_053
Plasmid#113591PurposeConstitutive expression of a single sgRNA and the fluorophore violet-excited GFP in immune cellsDepositorInsertsgRNA cloning site
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY0663 ACTB atgRNA with v2 scaffold
Plasmid#179108PurposeACTB N-term PBS 13 RT 29 Bxb1 AttB 46 atgRNA with v2 scaffoldDepositorInsertACTB N-term PBS 13 RT 29 AttB 46 atgRNA with v2 scaffold
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
HisMS2_VLP_FluA
Plasmid#175955PurposeGeneration of MS2 Virus-Like Particles packaged with the sequence for the Influenza A Matrix Protein [A/Illinois/20/2018(H1N1)]DepositorInsertM gene
ExpressionBacterialPromoterT7Available SinceSept. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHIV-H2BmRFP
Plasmid#18982DepositorInsertHistone H2B monomeric red fluorescent protein
UseLentiviralExpressionMammalianAvailable SinceSept. 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (AAV5)
Viral Prep#100835-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (#100835). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
EMTB-mScarletI
Plasmid#137801PurposeVisualization of microtubulesDepositorInsertEnsconsin microtubule binding domain
ExpressionMammalianPromoterCMVAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-beta-actin
Plasmid#178076PurposeInsect cell expression of beta-actinDepositorInsertbeta-actin (ACTB Human)
ExpressionInsectAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
R777-E095 Hs.FNTB
Plasmid#70379PurposeGateway ORF clone of human FNTB [NM_002028.3] with stop codon (for native or N-terminal fusions)DepositorInsertFNTB (FNTB Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_hsHAUScomplex_FL
Plasmid#202203PurposeBaculoviral transfer vector to co-express 8 subunits of human augmin complexDepositorInsertsHAUS1 (HAUS1 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS3 (HAUS3 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS2 (HAUS2 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS6 (HAUS6 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS7 (HAUS7 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS4 (HAUS4 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS5 (HAUS5 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS8 (HAUS8 codon-optimized form for expression in Trichoplusia ni cells, Human)
Tags-mGFP-TEV-TwinStrep and His-tag (6x)ExpressionInsectPromoterpolyhedrin promoterAvailable SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-GCP5
Plasmid#178071PurposeInsect cell expression of GCP5DepositorInsertGCP5 (TUBGCP5 Human)
ExpressionInsectAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
DENV2 NS2B-NS3 protease: Co-expression of DENV-2 NS2B and NS3
Plasmid#204808PurposeBacterial co-expression of Dengue2 NS2B and NS3 proteinsDepositorInsertDengue2 NS2B (POLY Dengue2)
ExpressionBacterialAvailable SinceDec. 18, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
EGFR-mEGFP
Plasmid#203774PurposeNumber and brightness analysis of EGFR oligomerizationDepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIN BRCA2 WT
Plasmid#16245DepositorInsertBRCA2 (BRCA2 Human)
ExpressionMammalianAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV asyn S129E
Plasmid#36068DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PTPN3
Plasmid#38966PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMVTO-TVMVP
Plasmid#179659PurposeTobacco Vein Mottling Viral ProteaseDepositorInsertTVMVP
ExpressionMammalianAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130989PurposeAAV vector to drive the expression of soma-targeted ChRmine-eYFP under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1PromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Mcm2-mVen
Plasmid#211398Purposemammalian expression of human Mcm2 C-terminally fused to mVenusDepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-DIO-hM4D(Gi)-mCherry
Plasmid#190240PurposeExpresses iDREADD fused to mCherry flanked by DIODepositorInserthM4D(Gi)-mCherry
UseAAVTagsmCherryPromotermouse CamKII alphaAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCh-Cry2WT
Plasmid#101221PurposeBlue-light dependent optogenetic protein Cry2DepositorInsertCry2PHR
UseLentiviralTagsmCherryExpressionMammalianPromoterSFFVAvailable SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC0049-EF1a-dPSPCas13b-NES-HIV, H133A/H1058A
Plasmid#103865PurposeCatalytically inactive PSPCas13b. RNase activity is inactivated by mutation of catalytic histidine residues in the HEPN domains (H133A/H1058A).DepositorInsertPspCas13b
UseCRISPR and LentiviralTags3xHA and HIV NESExpressionMammalianMutationContains the H133A and H1058A mutations which ina…PromoterEF1aAvailable SinceJan. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
actin CP alpha 2 beta 2
Plasmid#13452DepositorExpressionBacterialMutationnoneAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Rem2 RNAiR2
Plasmid#51585Purposeexpresses RNAi-resistant (RNAiR) myc-tagged mouse Rem2 (long version)DepositorInsertRem2 (Rem2 Mouse)
TagsmycExpressionMammalianMutationsilent mutations at shRNA 1 and 2 recognition sit…PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSB04X
Plasmid#117258PurposeGenome editing for Lactobacillus brevis ATCC367DepositorInsertCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019
UseOtherAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.0-mIghg1
Plasmid#127158PurposeExpression of secretory immunoglobulin heavy chains in mammalian cells, mouse (C57BL/6), IgG1 isotypeDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM-30-GST-Dmp68_B
Plasmid#145962PurposeBacterial Expression of Dmp68DepositorInsertDmp68 (Rm62 Fly)
ExpressionBacterialAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pREP-8xARE-GFP-SV40-BFP
Plasmid#134910PurposeNRF2 reporter plasmid with GFP under control of 8 ARE elements and constitutively transcribed BFPDepositorInserts8xARE- minimal promoter - GFP
TagBFP
ExpressionMammalianPromoter8xARE - minimal promoter and SV40Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-SNRK
Plasmid#23405DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-NEDD1
Plasmid#178073PurposeInsect cell expression of NEDD1DepositorInsertNEDD1 (NEDD1 Human)
ExpressionInsectAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
SpCas9 TadDE
Plasmid#193837PurposeExpress TadDE (with SpCas9) in mammalian cellsDepositorInsertTadA-DualEditor-Cas9D10A-2xUGI
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet
Plasmid#138086PurposeEmpty vector with Tet-response promoter for inducible expression of proteins. Can be transduced using Lentiviral particlesDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterminimal CMV promoter with heptamerized tet‐operat…Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
10 pCOLI_A_3C_C_GST
Plasmid#160246PurposeC-term GST 3C cleavable Amp resistant bacterial expression vectorDepositorTypeEmpty backboneTagsGSTExpressionBacterialPromoterT7Available SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pISH-Gucy2d-1
Plasmid#105459Purposeto generate a riboprobe for in situ hybridazationDepositorInsertGucy2d (Gucy2d Mouse)
UseTo ganerate riboprobeAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 (AAV1)
Viral Prep#100849-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 (#100849). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent NES-jRCaMP1b calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pet-ECHB(35-475)
Plasmid#96890Purposeexpresses His-tagged mouse ECHB (35-475) in E.coli cellsDepositorInsertTrifunctional enzyme subunit beta, mitochondrial (Hadhb Mouse)
TagsHis6 tagExpressionBacterialMutationdeleted amino acid 1-34PromoterT7Available SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOVC1_X_VfAU1-LOV
Plasmid#131185PurposeExpresses VfAU1-LOV domain (Vaucheria frigida) preceded by restriction sitesDepositorInsertVfAU1-LOV
ExpressionMammalianPromoterCMVAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only