We narrowed to 7,293 results for: GFP expression plasmids
-
Plasmid#176853PurposeExpresses SAPAP3 protein fused with eGFP at the N-terminus in neuronsDepositorInserteGFP-SAPAP3
UseAAVTagsGFPExpressionBacterialPromoterhSyn1Available SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 gfaABC1D-eGFP-SAPAP3
Plasmid#176859PurposeExpresses SAPAP3 protein fused with eGFP at the N-terminus in astrocytesDepositorInserteGFP-SAPAP3
UseAAVTagsGFPExpressionBacterialPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-GFP RanSen
Plasmid#184697PurposeLentiviral transfer plasmid for expression of GFP RanSenDepositorInsertGFP RanSen
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_vhhGFP4::T48-Baz::mCherry
Plasmid#163927PurposeExpression of GrabFP-A-extracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (extracellular) nanobody with T48 protein, Bazooka minimal localization sequence and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCL/IFNB1-d2eGFP-3’UTR
Plasmid#180232PurposeReporter plasmid utilizing d2eGFP as a reporter gene. Expression is designed to mimick IFNB1DepositorInsertd2eGFP
UseLentiviralPromoter1 kb upstream of IFNB1 CDSAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
phage UbiC scAB-GFP
Plasmid#104998PurposeLentiviral vector expressing sequence-optimized single chain Antibody-GFP fusion protein for SunTag labelingDepositorInsertsingle chain Antibody against GCN4
UseLentiviralTagsGB1, HA tag, and sfGFPExpressionBacterial and MammalianPromoterUbiCAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-GFP
Plasmid#197883PurposeCan be used to generate AAV virus that will express GFP in the presence of CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-Ku70siR-WT
Plasmid#46961PurposePlasmid for constitutive or doxycycline-inducible expression of wild-type human Ku70 resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorAvailable SinceAug. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSO221 Phis-72 BirA GFP
Plasmid#45100DepositorAvailable SinceJune 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Cas13d-T2A-GFP(1-10)
Plasmid#224566PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), Cas13d, and split GFP(1-10) reporter.DepositorInsertCas13d-T2A-GFP(1-10)
UseCRISPRTagsT2A-split GFP(1-10)Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Homo Sapiens, Human)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-T2A-ACREB-WPRE
Plasmid#40867DepositorInsertACREB
UseAAVPromoterCMVAvailable SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS316-OsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
Plasmid#198417PurposeExpresses both OsTIR1F74A and mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertOsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG::PSAML141F,Y115F:GlyR-IRES-GFP
Plasmid#32480PurposeExpresses PSAM-GlyR (L141F,Y115F) neuronal inhibitor, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-GlyR
TagsIRES-GFPExpressionMammalianPromoterCAGAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
Syn:eGFP-CaM-uTEV1Δ(220-242)
Plasmid#135463PurposeNeuronal expression of uFLARE protease componentDepositorInserteGFP-CaM-uTEV1Δ
UseAAVTagseGFP, V5ExpressionMammalianMutationS219V mutation improves stability and S153N impro…PromoterSynapsinAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-CaMKII-EGFP-T2A-FlipO
Plasmid#232791PurposeAAV2 vector containing EGFP and FlipO sequences separated by T2A peptide under the control of CaMKIIA promoter.DepositorInsertCaMKII-EGFP-T2A-FlipO
UseAAVAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TrHKII-pGFPN3
Plasmid#21921DepositorInsertTruncated human HKII cDNA (lacking the sequence encoded by exon 1, which is the mitochondrial binding domain) in pGFP-N3 plasmid (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKII cDNA sequence (l…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
meGFP-hTRAK1
Plasmid#188664Purposehuman TRAK1 with N-terminal meGFP tagDepositorAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN
Plasmid#50519PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
fgfprom luc
Plasmid#69446Purposebasal plasmid containing minimal fgf4 promoter used for testing enhancer activity of DNAs inserted immediately upstream of the promoter.DepositorInsertminimal fgf4 promoter
UseLuciferaseExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eArchT3.0-P2A-EGFP-WPRE-hGHpA
Plasmid#51110PurposeForebrain principal neuron expression of eArchT3,0 with physically uncoupled EGFP fluorophoreDepositorInserteArchT3.0
UseAAVTagsP2A-EGFPExpressionMammalianPromoterCaMKIIaAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-EGFP-WPRE-pA
Plasmid#37084PurposeCre-dependent expression of EGFPDepositorInsertEGFP
UseAAV and Cre/Lox; Cre-onPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJEP224-AAV-Basic-0.4αCaMKII-GFP-pA
Plasmid#62909PurposeAAV basic vector backbone designed to express GFP from a 0.4CaMKIIa promoter. It also contains a poly-Adenylation Signal (pA).DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter0.4αCaMKIIAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLEGFP-Y705F-STAT3
Plasmid#71445PurposeRetroviral expression of Y705F-STAT3. Please note that this plasmid contains Y705F-STAT3 tagged with FLAG, not GFP.DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-GFP(39TAG)
Plasmid#217360PurposeExpression of reporter EGFP with a TAG stop codon at 39 aa position; can be packaged into bacmidDepositorInsertEnhanced green fluorescent protein
UseBaculoviralExpressionInsect and MammalianMutationY39TAGPromoterCMVAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
CD8a-cNLS-EGFP
Plasmid#86052PurposeA mammalian expression plasmid expressing CD8a luminal and transmembrane domains followed by cNLS (classical nuclear localization signal) and C-terminus EGFP.DepositorInsertCD8a (CD8A Human)
TagsGFPExpressionMammalianMutationCD8a luminal and transmembrane along with two SV4…PromoterCMVAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAML141F,Y115F:5HT3HC-IRES-GFP
Plasmid#32477PurposeCre-dependent expression of PSAM-5HT3 HC (L141F,Y115F) neuronal activator, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceJan. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFP
Plasmid#32475PurposeCre-dependent expression of PSAM-5HT3 HC (Q79G,Q139G) neuronal activator, with IRES-EGFP markerDepositorInsertPSAMQ79G,Q139G-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(KRHWMR)-P2A-EGFP_(RAS3808)
Plasmid#228251PurposepCMV human expression plasmid for SpCas9 enzyme with KRHWMR amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(KRHWMR)-P2A-EGFP
TagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(ARGIMR)=D1135K, S1136R, G1218H, E1219W, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC-P2A-eGFP
Plasmid#179840Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc-P2A-eGFP expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC) and eGFPExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Cre
Plasmid#86805PurposeLentiviral vector that expresses an EGFP-Cre fusion protein with a nuclear localization signal from the CMV promoterDepositorInsertCre recombinase
UseCre/Lox and LentiviralTagsEGFP and nuclear localization signal: PKKKRKVExpressionMammalianPromoterCMVAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p150
Plasmid#117927PurposeADAR1-p150 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p110
Plasmid#117928PurposeADAR1-p110 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CXCL12-sfGFP
Plasmid#98961PurposeMammalian expression plasmid for superfolder GFP-fused human chemokine CXCL12DepositorInsertCXCL12 (CXCL12 Human)
TagsSuperfolder GFPExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
SP6-VEE-GFP
Plasmid#58976Purposeexpression of GFP using a self-replicating Venezuelan equine encephalitis (VEE) virus RNA repliconDepositorInsertEGFP
UseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoter26S subgenomic promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK3-2A-GFP
Plasmid#118286PurposeExpresses mouse DYRK3 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Poly(A)
Plasmid#65524PurposePlasmid for the generation of gene disruptions via Bxb1-mediated recombination into MIN-tagged cell lines. This vector can also be used to express cDNAs.DepositorInsertattB-GFP
UseMouse Targeting; Bxb1ExpressionMammalianAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK2-2A-GFP
Plasmid#118284PurposeExpresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Dyrk2 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK4-2A-GFP
Plasmid#118288PurposeExpresses mouse DYRK4 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Dyrk4 Mouse)
UseAAVTags2A peptide and EGFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-RPA70
Plasmid#164231Purposeretroviral plasmid for GFP-RPA70DepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only