We narrowed to 7,159 results for: GFP expression plasmids
-
Plasmid#32477PurposeCre-dependent expression of PSAM-5HT3 HC (L141F,Y115F) neuronal activator, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceJan. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFP
Plasmid#32475PurposeCre-dependent expression of PSAM-5HT3 HC (Q79G,Q139G) neuronal activator, with IRES-EGFP markerDepositorInsertPSAMQ79G,Q139G-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p150
Plasmid#117927PurposeADAR1-p150 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Cre
Plasmid#86805PurposeLentiviral vector that expresses an EGFP-Cre fusion protein with a nuclear localization signal from the CMV promoterDepositorInsertCre recombinase
UseCre/Lox and LentiviralTagsEGFP and nuclear localization signal: PKKKRKVExpressionMammalianPromoterCMVAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p110
Plasmid#117928PurposeADAR1-p110 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CXCL12-sfGFP
Plasmid#98961PurposeMammalian expression plasmid for superfolder GFP-fused human chemokine CXCL12DepositorInsertCXCL12 (CXCL12 Human)
TagsSuperfolder GFPExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
SP6-VEE-GFP
Plasmid#58976Purposeexpression of GFP using a self-replicating Venezuelan equine encephalitis (VEE) virus RNA repliconDepositorInsertEGFP
UseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoter26S subgenomic promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK3-2A-GFP
Plasmid#118286PurposeExpresses mouse DYRK3 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Poly(A)
Plasmid#65524PurposePlasmid for the generation of gene disruptions via Bxb1-mediated recombination into MIN-tagged cell lines. This vector can also be used to express cDNAs.DepositorInsertattB-GFP
UseMouse Targeting; Bxb1ExpressionMammalianAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK2-2A-GFP
Plasmid#118284PurposeExpresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Dyrk2 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK4-2A-GFP
Plasmid#118288PurposeExpresses mouse DYRK4 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Dyrk4 Mouse)
UseAAVTags2A peptide and EGFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(KRHWMR)-P2A-EGFP_(RAS3808)
Plasmid#228251PurposepCMV human expression plasmid for SpCas9 enzyme with KRHWMR amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(KRHWMR)-P2A-EGFP
TagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(ARGIMR)=D1135K, S1136R, G1218H, E1219W, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLeAPS-GFP-blast
Plasmid#182230PurposeLentiviral transfer plasmid for the LeAPS packaging system; encodes GFP-P2A-blasticidin transgeneDepositorInsertGFP-P2A-Blasticidin
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbV-EGFP
Plasmid#216161PurposeContains a Golden-Gate cloning cassette to express up to four gRNA and EGFPDepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-RPA70
Plasmid#164231Purposeretroviral plasmid for GFP-RPA70DepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst44-GFP
Plasmid#172310PurposeSST interneuron-restricted gene regulatory element GRE44, to drive GFP expression in SST+ interneuronsDepositorInsertSst44
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ACE2-GFP
Plasmid#154962PurposepcDNA3.1-ACE2-GFPDepositorAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[N150TAA]
Plasmid#164581Purposesuperfolder GFP with N150TAA mutationDepositorInsertsfGFP-150TAA
Tags6xHisExpressionBacterialMutationN150TAA MutationPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-vox-EGFP
Plasmid#79970Purposemammalian GFP reporter plasmid, target site for Vika recombinaseDepositorInsert2 vox-sites flanking neo in frame with EGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-DQNAT
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-LmnB1
Plasmid#164249Purposeretroviral plasmid for GFP-LmnB1DepositorAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLS
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFAP-Archon-EGFP
Plasmid#187979PurposeExpresses the fluorescent voltage indicator Archon under the GFAP promoterDepositorInsertArchon1-EGFP
UseAAVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN C124A
Plasmid#50520PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP726_L2_pV01_0I_TMV-tGFP_TCTP-fLUC
Plasmid#192406PurposeTo be a control plasmid that has no Rluc repression (replaced by turboGFP) and should reflect true off state of the circuit.DepositorInsertAct2::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN D92A
Plasmid#50521PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-MONARCH 1.0_crEGFP
Plasmid#224790PurposeLPUtopia matching RMCE donor plasmid with MONARCH 1.0 circuit with crRNA targeting EGFP. Use BlastR for positive and HSV-TK for negative selectionDepositorInsertcrEGFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC-P2A-eGFP
Plasmid#179840Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc-P2A-eGFP expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC) and eGFPExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP WT
Plasmid#197575PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin of replicationDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialPromoteraraC and lppAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
eGFP-PRM-3R
Plasmid#112156PurposeMammalian eGFP expression plasmid for PRM-3R.DepositorInsertPRM-3R (ABL1 Human)
ExpressionMammalianMutationcontains only the PRM domain of ABl1PromoterCMVAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only