173,176 results
-
Plasmid#214925PurposeExpresses mitochondrially targeted non-responsive controlDepositorInsert(mito).cpSFGFP.HaloTag
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUW H2B-mTagBFP2-P2A-PuroR
Plasmid#239552PurposeExpression and nuclear localization of mTagBFP2DepositorArticleInsertmTagBFP2
UseLentiviralPromoterUbCAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-HM4Di-YFP
Plasmid#209193PurposeCre-dependent expression of Hm4Di fused to YFP; ChemogeneticsDepositorInsertHm4Di
UseAAVTagsYFPExpressionMammalianPromoterCAGAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_007 - TetO-NLS-RfxCas13d-NLS-WPRE-EFS-rtTA3-2A-Blast
Plasmid#138149PurposeExpresses RfxCas13d in mammalian cells for knockdown of target RNAs in combination with compatible crRNAs. Localized to the nucleusDepositorInsertCasRx
UseLentiviralTagsNLS-HAAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-jGCaMP8s-WPRE (AAV1)
Viral Prep#176752-AAV1PurposeReady-to-use AAV1 particles produced from AAV-CamKIIa-jGCaMP8s-WPRE (#176752). In addition to the viral particles, you will also receive purified AAV-CamKIIa-jGCaMP8s-WPRE plasmid DNA. CamKIIa-driven expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCamKIIalphaAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI Probe
Plasmid#211507PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol (PI) from bacteriaDepositorInsertBcPI-PLC-ANH
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3,5)P2 Probe
Plasmid#211512PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3,5-Bisphosphate (PI(3,5)P2) from bacteriaDepositorInsertSnxA-2xPX
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(4)P Probe
Plasmid#211509PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-4-Phosphate (PI(4)P) from bacteriaDepositorInsertSidC (P4C)
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3)P Probe
Plasmid#211508PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3-Phosphate (PI(3)P) from bacteriaDepositorAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 (AAV9)
Viral Prep#100848-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 (#100848). In addition to the viral particles, you will also receive purified pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 plasmid DNA. Syn-driven jRCaMP1a calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDest17_N-myc
Plasmid#234045PurposeBacterial expression of N-terminally 6His-tagged N-myc; includes TEV cleavage siteDepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX-PVX
Plasmid#213040PurposePVX vector to express heterologous sequences in plantsDepositorInsertPotato virus X
ExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti.DTR.GFP
Plasmid#201962PurposeLentiviral vector that expresses diptheria toxin receptor (DTR) C-terminally fused to EGFPDepositorInsertDiptheria Toxin Receptor
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1alphaAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-Pink1
Plasmid#101874PurposeTransient expression of Pink1-YFP in mammalian cellsDepositorInsertPTEN induced putative kinase 1 (PINK1 Human)
Tagsfluorescent tag EYFPExpressionMammalianPromoterCMVAvailable SinceOct. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMV306G13+Lux
Plasmid#26160DepositorInsertG13 promoter + Bacterial luciferase operon
ExpressionBacterialMutationIt contains a gram-positive enhanced translation …Available SinceFeb. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE (AAV9)
Viral Prep#104488-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA. Synapsin-driven GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2
Plasmid#132775PurposePrime editing in mammalian cells. This plasmid is used by PE2, PE3, and PE3bDepositorInsertPE2
TagsSV40 NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#162375-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1
Plasmid#83842PurposeFluorescent probe for S/G2 transition and G2/M transition, one of two plasmids for the FUCCI4 systemDepositorUseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry-LATeNT
Plasmid#240992PurposeCre-dependent expression of LATeNTDepositorInsertmCherry-V5-LATeNT
UseAAVTagsV5 (internal)ExpressionMammalianAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N)
Plasmid#196703PurposePlasmid for transient mammalian expression of catalytically inactive RNase H1 mutant.DepositorInserthuman RNaseH1 D210N
ExpressionMammalianMutationD210N, catalytically inactiveAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP (AAV9)
Viral Prep#117382-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified pAAV-hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSFFV_mNG2(11)1-10
Plasmid#82610PurposeLentiviral vector of constitutive expression of mNeonGreen2(1-10)DepositorInsertmNeonGreen2(1-10)
UseLentiviralExpressionMammalianMutationK128M, S142T, R150M, G172V and K213MPromoterSFFVAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ExRai-AMPKAR
Plasmid#192446PurposeGenetically encoded excitation-ratiometric fluorescent biosensor for monitoring AMPK activity in living cells.DepositorInsertExRai-AMPKAR
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tagExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF3550
Plasmid#145026PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens. This is the control vector for the collection.DepositorInsertmCherry
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ppyCAG_RNaseH1_WT
Plasmid#111906PurposeExpress RNASEH1 in mammalian cell.DepositorAvailable SinceJuly 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
YY105: pPB_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228882PurposePiggyBac plasmid expressing the HaloTag-GEMINI(A) under the control of a doxycycline-inducible promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertHaloTag-fused GEMINI(A)
ExpressionMammalianPromoterTREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ancBE4-SpRY
Plasmid#226855PurposeExpresses ancBE4max-SpRY base editor in mammalian cells with eGFP markerDepositorInsertancBE4max-SpRY
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV8)
Viral Prep#51502-AAV8PurposeReady-to-use AAV8 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre-dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH2.10_Gag-MCP-P2A-eGFP
Plasmid#205525PurposeExpress HIV Gag-MCP-P2A-eGFPDepositorInsertGag-MCP
ExpressionMammalianMutationWTPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmal_c5x_RNAse_Inhib
Plasmid#153314PurposeBacterial expression of an RNase inhibitorDepositorInsertRNAse Inhibitor
TagsMaltose Binding ProteinExpressionBacterialAvailable SinceJune 2, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJR98
Plasmid#187239PurposeCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sitesDepositorInsertCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sites
ExpressionBacterialAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-hSyn-hM4D(Gi)-mCherry (AAV1)
Viral Prep#50475-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dual-sgRNA_hU6-mU6
Plasmid#154194PurposeLentiviral expression plasmid for two sgRNAs from a hU6 and a mU6 promoter. The cloning site design allows a one-step cloning strategy of both sgRNAs. Expresses a Thy1.1 marker.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET22b-csgA
Plasmid#89581PurposeExpress csgA curli protein with GS linker and HistaqDepositorAvailable SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only