165,947 results
-
Plasmid#225754PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with nuclear-localized mTagBFP2-NLS; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGEX-2TK 14-3-3 sigma GST
Plasmid#11944DepositorAvailable SinceMay 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-BRLF1(Rta)
Plasmid#195824PurposeGateway Entry Clone of Epstein-Barr virus BRLF1DepositorInsertBRLF1 (BRLF1 Epstein-Barr virus)
UseGateway entry vectorAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NR2A
Plasmid#17924DepositorAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
Lenti-eCas9-sgNT
Plasmid#140238PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a control non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAUX_OL
Plasmid#166246Purposeuse as an auxiliary temperature-sensitive plasmid to successfully transform pdCas9_CL plasmidDepositorInsert[P112-sgRNA-term]-[J23116_B34-dCas9-B15]
ExpressionBacterialPromoterEc-TTL-P112 and BBa_J23116Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHeACT-mEGFP-NLS
Plasmid#205003PurposeThe vector contains 1kbp of the upstream and downstream regions of the actin gene from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the actin gene from Hypsibius exemplaris
UseTardigrade expressionAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2932
Plasmid#144408PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-FLAG PHGDH
Plasmid#212995Purposeexpresses human PHGDHDepositorAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEGFP
Plasmid#18696DepositorInsertmonomeric EGFP
ExpressionMammalianMutationA206K mutationAvailable SinceJuly 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
6x-His_A1aY1_GFP
Plasmid#158753PurposeBacterial expression of 6xHis-A1aY1 fused with carboxy terminus GFP for recombinant purificationDepositorInsert6xHistidine_A1aY1_GFP
Tags6x-Histidine tag, GFP, T7 leader sequence, and Th…ExpressionBacterialPromoterT7Available SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hs.NRAS Q61R
Plasmid#83179PurposeGateway ORF Entry clone of human NRAS [NM_002524.4 ] with stop codon (for native or N-terminal fusions), Q61R mutationDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR_SFFV
Plasmid#79121PurposeLentiviral vector for constitutive expression of genes (SFFV promoter)DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pF1-Hs Cdk1/cyclin B1
Plasmid#177330PurposeCo-expression of the human active Cdk1/cyclin B1 kinase complexDepositorTags2 x Strep-tag and 8 x HisExpressionInsectAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
ITPR1_Halo_N_allele
Plasmid#178161PurposeDonor vector for endogenous tagging of human ITPR1 at the N-terminus with halotagInsertHalotag (ITPR1 Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Gluc-RMA-IRES-EGFP
Plasmid#189629PurposeExpresses Gluc-RMA and EGFP under the hSyn promoter. Gluc-RMA for monitoring neuronal transduction.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBE48
Plasmid#174656PurposeCAPTURE method BAC origin of replication receiver plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_25bpLinker
Plasmid#157788PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 25 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_25bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro DEST (w529-2)
Plasmid#19068Purpose3rd gen lentiviral Gateway destination vector, expression, PGK promoter, PuroDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mEGFP
Plasmid#175293PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mEGFP
TagsmEGFPExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-SPOTlight-U2GCR
Plasmid#231889PurposeCre-dependent reporter to measure ISR state-dependent protein synthesisDepositorInsertDIO-SPOTlight-U2GCR
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJK511
Plasmid#155384PurposedCas12a oscillator, reverse direction crRNAs. dCas12a (D917A) + PA4-mVenusDepositorInsertsdCas12a (F. novicida)
PA4-mVenus
dCas12a oscillator crRNAs
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)Available SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
LAMP1-SEP-mRuby3
Plasmid#200939Purposeendolysosome localized pH sensor using sensorsuperecliptic pHluorin (SEP) and mRuby3DepositorInsertsUseLentiviralAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
RP156 pUAST EGFP:Gr21a
Plasmid#59524PurposeN-terminal fusion of EGFP to Drosophila melanogaster Gr21aDepositorAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPBT-peRNA_GG-Puro
Plasmid#173220PurposepiggyBac transposon containing hU6 promotor and pegRNA cloning siteDepositorInsertspegRNA cloning cassette
PuroR
UsePiggybacExpressionMammalianPromoterEF1-a and hU6Available SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_YWHAZ_14-3-3
Plasmid#109808PurposeProtein expression and purification of YWHAZ_14-3-3DepositorInsertYWHAZ_14-3-3 (YWHAZ Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L1-ESYN-L4
Plasmid#32580DepositorInsertEnhanced Synapsin Promoter
UseGateway cloning vectorAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSC5
Plasmid#104779PurposepSC218GG-Glycine max Ubiquitin:Gateway expression cassette binary vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
5KKP (PUS7)
Plasmid#101878PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceApril 30, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits