We narrowed to 12,964 results for: BASE
-
Plasmid#179140PurposeBinder: SspB that carries two point mutations reducing homodimerization(Y11K/A15E, residue numbering from pdb: 1ou9) and an additionional A70Q mutation greatly reduces affinity for SsrA peptideDepositorInsertSspB
TagsFLAG and mCherryExpressionMammalianMutationY11K/A15E, residue numbering from pdb: 1ou9. Addi…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos2.0
Plasmid#73228PurposeGenome editing for gene xylR (cbei-2385) in clostridium beijerinckii NCIMB 8052DepositorInsertsCas9 nickase
sgRNA to xylR
UseE.coli - clostridium shuttle vectorMutationD10APromoterPj23119 and PthlAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK-caCas9-NatMX-Neut5L-Leu2 drive
Plasmid#89578PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locusDepositorInsertLeu2 gene drive
ExpressionYeastAvailable SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEL035
Plasmid#137903PurposeSTU2.0 SpyCas9(D10A)-PmCDA1 for plant genome base editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-LATS1
Plasmid#172986Purposeconstitutive expression of FLAG-tagged LATS1DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-2A-rtTA-TcVA
Plasmid#24592DepositorInsertGateway(TM) cassette
UseLentiviralTagsVAExpressionMammalianAvailable SinceAug. 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
NKP66 pEGFP-N2 (1176)
Plasmid#62039Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-mNeon-ACTB
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-2
Plasmid#228984PurposeFor bacterial expression of anti-GST nanobody GST-2, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-1--LaG94-14
Plasmid#228973PurposeFor bacterial expression of anti-GFP nanobody dimer of LaG94-1 and LaG94-14, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertLaG94-1--LaG94-14
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-1
Plasmid#228983PurposeFor bacterial expression of anti-GST nanobody GST-1, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-1
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-1
Plasmid#228974PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-1, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-1
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-7
Plasmid#228997PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-7, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-7
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-1
Plasmid#228995PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-1, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-1
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-5
Plasmid#228991PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-5, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-5
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-LMNB1
Plasmid#207773PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Puro-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIRESpuro-Flag-Pol b
Plasmid#23257DepositorAvailable SinceMay 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-TAOK1
Plasmid#172991Purposeconstitutive expression of FLAG-tagged TAOK1DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mNeonGreen
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GFP10-RHOA
Plasmid#133068PurposeExpresses RHOA GTPase with tripartite split GFP10DepositorInsertras homolog family member A (RHOA Human)
TagsGFP10 (split-GFP tripartite)ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEL066
Plasmid#124897PurposeFor genome editing in plant by SpCas9 variant(SpCas9-NG) (D10A)-PmCDA1-UGI base editorDepositorTypeEmpty backboneUseCRISPRTags3xFlagExpressionPlantAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRD405
Plasmid#163110PurposeExpression of mScarlet-I_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mScarlet-I_H-NSdbd_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQ54-VC
Plasmid#175060Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ54) in mammalian cellsDepositorInsertpolyQ54 (HTT Human)
TagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQ25-VC
Plasmid#175062Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ25) in mammalian cellsDepositorInsertpolyQ25 (HTT Human)
TagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TC1316
Plasmid#164883PurposeCMV-bpNLS-dCas13d-bpNLS-ADARdd-mCherry, ADARdd embeded in loop3DepositorInsertdcas13d-ADARdd
ExpressionMammalianMutationdCas13d L560-G586 deletedPromoterCMV, T7Available SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-SBP-VAP-A*
Plasmid#120175PurposeExpresses a chimera of GFP (fluorescent tag), SBP tag and the C-terminal of ER-resident protein VAP-ADepositorInsertVAMP associated protein A (VAPA Human)
TagsEGFP and SBPExpressionMammalianMutationTruncated VAP-A: 118-249PromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CADPS KI
Plasmid#131482PurposeEndogenous tagging of CAPS1: N-terminal (amino acid position: S39)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
CD3-2A_pMI-LO
Plasmid#153418PurposeRetroviral (MSCV) expression of all four WT CD3 subunits, co-expressed with LSSmOrangeDepositorInsertmurine CD3 delta-gamma-epsilon-zeta subunits (Cd3d Mouse)
UseRetroviralExpressionMammalianAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
YET1000: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X4)
Plasmid#104571PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to four DmrA domainsDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to four DmrA domains
UseCRISPRTagsNLS-3xHA-3xFLAG-4xDmrAExpressionMammalianMutationD832APromoterCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-TAOK2
Plasmid#172992Purposeconstitutive expression of FLAG-tagged TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mNeon-ACTB
Plasmid#207752PurposeDonor template for Puro-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQ39-VC
Plasmid#175061Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ39) in mammalian cellsDepositorInsertpolyQ39 (HTT Human)
TagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRD406
Plasmid#163111PurposeExpression of mNeonGreen_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mNeonGreen_H-NSdbd_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD399
Plasmid#163106PurposeExpression of mEGFP_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mEGFP_H-NSdbd_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
HT103_FCMV_QuasAr6a_Citrine
Plasmid#178822PurposeExpresses an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6a carrying a Citrine expression tagDepositorInsertQuasAr6a_Citrine
UseLentiviralTagscitrineExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SNX10-PX (1-201)
Plasmid#119091PurposeBacterial expression of human phox homology (PX) domain, SNX10-PX (1-201)DepositorAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti PA-mCit
Plasmid#113451PurposeLentiviral ProteinA-mCitrine expression vectorDepositorInsertProteinA-mCitrine
UseLentiviralExpressionMammalianPromoterhUBbCAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmaxRH
Plasmid#206884PurposeExpresses FLAG-tagged PEmax (lacking the RNAseH domain) fused to Gag through a linker sequenceDepositorInsertPEMax Delta RNAseH
TagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAaePUb::Cas9-2A-Neo
Plasmid#176680PurposeExpression of Drosophila codon optimized spCas9 under Ae. aegypti Polyubiquitin promoter (AAEL003888)DepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterAe. aegypti poly-ubiquitin (AAEL003888)Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFUGW ORANGE Tubb3-GFP KI _ mCherry-KASH
Plasmid#131508PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorUseLentiviralExpressionMammalianPromoterhUBCAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLOW31
Plasmid#172698PurposeC. elegans mScarlet co-injection markerDepositorInsertPmyo-3::mScarlet
TagsmScarletExpressionWormPromotermyo-3Available SinceAug. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGLOW77
Plasmid#177338PurposeC. elegans mNeonGreen co-injection markerDepositorInsertPmyo-2::mNeonGreen
TagsmNeonGreenExpressionWormPromotermyo-2Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR(Y107A)-Hygro
Plasmid#176073PurposeEGFP fused to the C-terminus of a WWE domain containing the mutation Tyr107Ala & a hygromycin resistance cassetteDepositorInsertLivePAR (Y107A)
UseLentiviralTagsEGFPExpressionMammalianMutationPoint mutation to convert Try107 to AlaPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
HT109_pAAV_hSyn-DiO-SomQuasAr6a_EGFP
Plasmid#190878PurposeCre-on expression of soma-targeted QuasAr6a under an neuronal promoterDepositorInsertsomQuasAr6a_EGFP
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Ptet-nCas9-BE
Plasmid#195739PurposeExpress APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coliDepositorArticleInsertTet repressor protein / APOBEC1-nCas9(D10A)-UGI
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPtet(Tetracycline inducible protein)Available SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only