We narrowed to 13,316 results for: ache
-
Plasmid#86755PurposeN-terminal myc-tagged protein expression in mammalian cellsDepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only
-
myc-Atg14 (181-413)
Plasmid#86754PurposeN-terminal myc-tagged protein expression in mammalian cellsDepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
myc-Atg14 (201-492)
Plasmid#86751PurposeN-terminal myc-tagged protein expression in mammalian cellsDepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-iGluSnFR.A184V
Plasmid#106187PurposeMedium affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.A184V
UseAAVMutationGltI: A184VPromoterCAGAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pRB112
Plasmid#180173PurposepAAV construct GluN1WT (shRNA resistant)DepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-RVR
Plasmid#108861PurposeLbCpf1 Gateway entry plasmid with G548R, K554V and Y558R mutationsDepositorInsertLbCpf1-RVR (LbCpf1 with G548R, K554V and Y558R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationG548R, K554V and Y558R, Cpf1 is rice codon optimi…Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2-CMV/TetO2-EYFP-GW
Plasmid#153309PurposeTet-On YFP-tagged Gateway destination vector, to be used together with pT2-TetR-neoR transposon plasmidDepositorTypeEmpty backboneUseTransposonTagsYellow Fluorescent ProteinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNK3203
Plasmid#219749PurposeDVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - mcitHispS - tSV40
ExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS423-mitoT
Plasmid#174525PurposeExpresses yeast variant of mitoT synthetic intermembrane tether bridging the inner and outer mitochondrial membranesDepositorInsertYeast mitochondrial intermembrane tether
UseSynthetic BiologyTagseGFPExpressionYeastPromoterMET25Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_FNDC3B
Plasmid#45269DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Aurora
Plasmid#98167Purposered-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
TagsmCherryExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…PromoterCMV (+enhancer)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-GAP43-ECFP-stop-L2
Plasmid#186356PurposeEntry clone with ORF encoding plasma membrane-targeted GAP43-eCFP flanked by Gateway recombination sequencesDepositorInsertGrowth-associated protein-43 (Gap43 Synthetic, Mouse)
UseExpression of a fluorescent membrane markerTagsECFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-HA-FLAG-AU1
Plasmid#162098PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to HA-FLAG-AU1
UseLentiviralTagsHA-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-ProtC
Plasmid#162099PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-ProtC
UseLentiviralTagsVSVg-StrepTagII-ProtCMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-1
Plasmid#133353Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
MP6.6TAG_AraC_Para-dnaQ926-dam-seqA-emrR-ugi-CDA1.6TAG
Plasmid#163719PurposeArabinose-inducible expression of six mutagenesis genes, each encoding one amber codon after the initiator methionineDepositorInsertaraC dnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TAG CDA1.1TAG
ExpressionBacterialMutationdnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TA…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase_PCi_PC-σ
Plasmid#214040PurposeBacterial expression plasmid for SAVED-CHAT, PCaspase, PCi, and PC-σ from Haliangium ochraceumDepositorInsertSAVED-CHAT-Pcaspase-Pci-PC-σ
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2 mCherry-Rtn4HD
Plasmid#86685PurposeLentivirus to stably express fluorescent human protein in mammalian cellsDepositorInsertRtn4 homology domain (RTN4 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationhomology domain onlyPromoterCMVAvailable SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SF-iGluSnFR.S72A
Plasmid#106194PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVMutationGltI: S72APromoterGFAPAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2 GFP-Rtn4HD
Plasmid#86686PurposeLentivirus to stably express fluorescent human protein in mammalian cellsDepositorInsertRtn4 homology domain (RTN4 Human)
UseLentiviralTagsGFPExpressionMammalianMutationhomology domain onlyPromoterCMVAvailable SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NOPLight-ctr
Plasmid#195579PurposeExpresses the control sensor NOPLight-ctr in mammalian cellsDepositorInsertNOPLight-ctr
ExpressionMammalianMutationD110A, D130APromoterCMVAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-Ensconsin-3XGFP-stop-L2
Plasmid#186361PurposeEntry clone with ORF encoding the MT-binding domain of Ensconsin fused to 3 copies of GFP in C-terminal, flanked by Gateway recombination sequences.DepositorInsertHuman Ensconsin (MAP7 Synthetic, Human)
UseExpression of a fluorescent microtubule markerTags3xEGFPAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
rgef-1p::NmBirA
Plasmid#79971Purposeencodes E.coli biotin-ligase under neuronal promotor for C.elegansDepositorInsertBirA
TagsNLS::mycExpressionWormPromoterrgefAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A hu_ncOGT WT (open N-term)
Plasmid#155197PurposeEntry vector encoding non-tagged O-GlcNAc Transferase with open N-terminusDepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway cloningMutationWT OGT with no start codon, in-frame with gateway…Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165493PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterCaMKIIAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-USPL1-C236A-pcDNA3.1
Plasmid#85764Purposemammalian expression of full length HA tagged USPL1, catalytic inactive variant C236ADepositorInsertUSPL1, full length, catalytic inactive variant variant C236A (USPL1 Human)
TagsHAExpressionMammalianMutationcatalytic inactive mutant C236APromoterCMVAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-USPL1-C236S-pcDNA3.1
Plasmid#85763Purposemammalian expression of full length HA tagged USPL1, catalytic inactive variant C236SDepositorInsertUSPL1, full length, catalytic inactive variant variant C236S (USPL1 Human)
TagsHAExpressionMammalianMutationcatalytic inactive mutant C236SPromoterCMVAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-ccdB-mRuby3
Plasmid#166139PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a CEN/ARS element for low copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgA1
Plasmid#187009PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1DepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
shTCF7L2 # 2
Plasmid#42558DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKK-NoTag
Plasmid#105767PurposeControl vector for pKK series (encodes only SLIC arms (TEV-L and TEV-R)); expression without tag. Useful to design other vectors; any tag can be added.DepositorTypeEmpty backboneUseFlp-in competentExpressionMammalianAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-hMSN
Plasmid#211823PurposeExpress human MSN in mammalian cellsDepositorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSynapsin1_NOPLight1
Plasmid#195580PurposeExpresses NOPLight1 in neuronsDepositorInsertNOPLight1
UseAAVExpressionMammalianPromoterhuman Synapsin-1Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT-TO-Nsp7-Nsp8_GC3opt
Plasmid#157691Purposemammalian expression of untagged SARS-CoV-2 Nsp7-Nsp8 fusion protein under control of a tetracycline-inducible promoterDepositorInsertNsp7-Nsp8_GC3opt (ORF1ab SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti-EFS-hTSC1-T2A-Bsd
Plasmid#193199PurposeLentiviral vector expressing human TSC1 cDNA (driven by EFS promoter) and a blasticidin resistance markerDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-Klf4
Plasmid#136613PurposeDox-inducible lentiviral vector expressing mouse Klf4DepositorAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9-PGK-mCherry-WPRE
Plasmid#87919PurposeHIV-1 SIN lentiviral transfer vectorDepositorInsertsgHTT1, shGFP2, sgCas9, cherry
UseLentiviralPromoterH1, U6, 7SK, PGKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
SopB-EGFP
Plasmid#183655PurposeC-terminally tagged Salmonella Typhimurium SopB for mammalian expressionDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKK-FLAG-TEV
Plasmid#105768PurposeExpression of your protein of interest in fusion with FLAG at the N-terminus. The tag is cleavable by TEV protease or enterokinase.DepositorTypeEmpty backboneUseFlp-in competentTagsFLAG-TEVExpressionMammalianAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-MRPP3-His
Plasmid#67866Purposebacterial expression of PRORP (KIAA0391), full coding sequence (mitoch. form) + C-term. His tagDepositorInsertMRPP3 (KIAA0391 Human)
TagsHisExpressionBacterialMutationAmino acid 46 of recombinant MRPP3 is preceded by…PromoterT7Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 D122A HA pCAGGS
Plasmid#206097Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only