We narrowed to 7,778 results for: CCH
-
Plasmid#29387DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationG181A mutant gene including genomic sequence 1432…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH374-SUP45-R62A
Plasmid#29391DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationR62A mutant gene including genomic sequence 1432 …Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH356-SUP45-T295A
Plasmid#29389DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationT295A mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH393-SUP45-T357A
Plasmid#29392DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationT357A mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH357-SUP45-T388A
Plasmid#29393DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationT388A mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH363-SUP45-F401Y
Plasmid#29394DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationF401Y mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH364-SUP45-Y410F
Plasmid#29395DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationY410F mutant gene including genomic sequence 1432…Available SinceMay 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 L306P
Plasmid#169262PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 L306PDepositorInsertNop4 L306P (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationp.(Leu306Pro)PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE5
Plasmid#169263PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 5DepositorInsertNop4 delta E5 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE8
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Ppgk1-PYC-Ttpi1
Plasmid#127735PurposeYeast pathway position 5. PYC transcription unit with the PGK1 promoter and TPI1 terminator.DepositorInsertpyruvate carboxylase (PYC1 Synthetic, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterPpgk1AvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Ppxr1-PYC-Tnat1
Plasmid#127736PurposeYeast pathway position 5. PYC transcription unit with the PXR1 promoter and NAT1 terminator.DepositorInsertpyruvate carboxylase (PYC1 Synthetic, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterPpxr1AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2GFP
Plasmid#82416Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning siteDepositorInsertGFP
UseCRISPR and LentiviralPromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDisCoTune
Plasmid#173713PurposePromotes expression of disulfide-rich protein in E. coli T7 expression system. The plasmid encodes expression of the folding factors Erv1p and hPDI controlled by the Ptac promoter.DepositorInsertsExpressionBacterialAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pseudojanin (PJ)
Plasmid#37999DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pv6_MCPH1-TandemBRCT
Plasmid#250354PurposeExpresses tandem BRCT domain from MCPH1 fused to eGFP. Can be used to detect yH2AX at DNA damage sites.DepositorInsertMCPH1 tandem BRCT
TagsNLS, eGFP and biotintag, TEV cleavageExpressionMammalianPromoterCAGGSAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-RFP
Plasmid#1817PurposeMammalian expression of Lamp1 fused to RFP. Used for localization to the lysosome.DepositorInsertlysosome associated membrane protein 1 (Lamp1 Rat)
TagsRFPExpressionMammalianMutationD50E (not important for function of plasmid)Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
pNatA (pACYCduet-naa10-naa15)
Plasmid#72928PurposeAllows expression of a modified version of the fission yeast NatA complex - chloramphenicol markerDepositorExpressionBacterialMutationCodon optomised for E.coli expressionPromoterT7Available SinceFeb. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGTM_YR375_SUMO_Protease_001
Plasmid#190063PurposeExpresses the yeast Ulp1 Sumo protease in active form as a TEV protease-cleavable MBP fusionDepositorInsertULP1_YEAST (ULP1 Budding Yeast)
Tags8X His-MBP (Maltose Binding Protein)ExpressionBacterialMutationConstruct contains residues 347 – 621PromoterT7 lacAvailable SinceJan. 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pv6_MCPH1_BRCT W706RW815R
Plasmid#250355PurposeExpresses mutant tandem BRCT domain from MCPH1 fused to eGFP. Serves as control.DepositorInsertMCPH1 tandem BRCT
TagsNLS, eGFP and biotintag, TEV cleavageExpressionMammalianMutationW706R and W815RPromoterCAGGSAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNESx2-EGFP-C1-PABDx2-Spo20
Plasmid#220082PurposePA biosensor with tandem Spo20-PABDs and two NES domains to aid in nuclear exportDepositorInsertSpo20 (SPO20 Budding Yeast)
TagsX. leavis map2k1.L(32-44)-GGSG-X. leavis map2k1.L…ExpressionMammalianMutationamino acids 51-91, tandem dimerPromoterCMVAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
HDAC4 Flag
Plasmid#13821PurposeMammalian expression of human histone deacetylase 4 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSPIH6
Plasmid#190676PurposeE. coli plasmid for single step cloning of SUMO-peptide-intein (SPI) fusion proteins (contains SUMO and His-tagged intein)DepositorInsertsSmall ubiquitin-like modifier
Mxe GyrA intein with C-terminal chitin binding domain and His tag
TagsChitin binding domain, His tag, and N-terminal Hi…ExpressionBacterialMutationAdded C-terminal his tag and NonePromoterT7Available SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hGABARAP
Plasmid#87871PurposeExpress a EGFP-human GABARAP in mammalian cellsDepositorInsertGABARAP (GABARAP Human)
ExpressionMammalianAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-betaCatenin
Plasmid#114281PurposeTET-inducible expression of a constitutively active form of the BetaCatenin proteinDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2Cre
Plasmid#82415PurposeLentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning siteDepositorInsertCre Recombinase
UseCRISPR, Cre/Lox, and LentiviralMutationMutated BsmBI cut sitePromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Mitotrap
Plasmid#46942PurposeExpresses Mitotrap in mammalian cellsDepositorInsertMitotrap (MTOR Budding Yeast, Human, Aequorea victoria, Synthetic)
TagsThis is a fusion between a yeast mitochondrial ta…ExpressionMammalianAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nef-CIAO-Flp
Plasmid#149294PurposeCre-dependent expression of Flp recombinase.DepositorInsertFlp recombinase (flp Budding Yeast)
UseAAVMutationDerived from the mouse codon-optomized FlpO. The…Available SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-YFP
Plasmid#1816PurposeMammalian expression of Lamp1 fused to YFP. Used for localization to the lysosome.DepositorInsertlysosome associated membrane protein 1 (Lamp1 Rat)
TagsYFPExpressionMammalianMutationD50E (not important for function of plasmid)Available SinceFeb. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJBEI-6409
Plasmid#47048PurposeBglBrick plasmid (=pBbA5c-MTSAe-T1f-MBI(f)-T1002i-Ptrc-trGPPS(co)-LS) coding for MEV pathway enzymes to produce limonene from glucose in E. coliDepositorInsertCodon-optimized sequences for MEV pathway expression in E. coli to produce limonene
UseSynthetic Biology; BglbrickExpressionBacterialMutationR364S mutation in MKPromoterPlacUV5Available SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
Cas9-NAT
Plasmid#64329PurposeCas9 expression cassette carried by a yeast single-copy episome plasmidDepositorInsertHuman-optimized S. pyogenes Cas9 with Clonnat marker gene expression cassette
UseCRISPRExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFS_1113_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_J23103-Leader-ARRAY2-DR2-FaqI_Term_NotI
Plasmid#184741Purposeencodes aTc inducible FsRT-Cas1–Cas2 expression cassette and FsCRISPR Array 2 transcribed by BBa_J23103DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
ExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFS_1142_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_J23103-Leader1-ARRAY1-DR1-FaqI_Term_NotI
Plasmid#184742Purposeencodes aTc inducible FsRT-Cas1–Cas2 expression cassette and FsCRISPR Array 1 transcribed by BBa_J23103DepositorInsertFsRT-Cas1(opt)-Cas2(opt)
ExpressionBacterialMutationsequence codon optimized for expression in E. coliPromoterpTetAAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nef-CIAO2-Flp
Plasmid#149296PurposeCre-dependent expression of Flp recombinase.DepositorInsertFlp recombinase (flp Budding Yeast)
UseAAVMutationDerived from the mouse codon-optomized FlpO. The…Available SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Yiplac211 proGAL1-TsCC(A)-RGG-GFP-RGG-RGG
Plasmid#176395PurposeExpresses GFP tagged triple RGG scaffold with N-terminal TsCC(A) coiled coil. Expression induced in media containing galactose.DepositorInsertGAL1 promoter, TsCC(A)-RGG-GFP-RGG-RGG
ExpressionYeastPromoterGAL1Available SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBMN_HA-TBK1 (kinase dead - D135N)
Plasmid#199206PurposeUsed for the expression of TBK1 carrying a kinase dead mutation D135N (SMC Internal No. 1997)DepositorAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-hsp70I:QFGal4-SV40pA
Plasmid#155120PurposeTol2 vector for heat-shock inducible expression of QFGal4. Contains cmlc2:mRFP-SV40pA transgenesis markerDepositorInserthsp70l:QFGal4 (hsp70l Zebrafish, Budding Yeast, Neurospora crassa)
UseZebrafish expressionPromoterhsp70lAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-M13-TevC-IRES-SP6-Cre
Plasmid#171620PurposeM13-TevC with CreDepositorInsertM13-TevC-IRES-SP6-Cre
UseAAV and Synthetic BiologyTags6x HisExpressionMammalianPromoterhSynAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only