We narrowed to 9,286 results for: Pol
-
Plasmid#162586PurposeExpresses norovirus GI.1 VP1 protein with mutations G131C-N172C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlycine 131 changed to Cysteine and Asparagine 17…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N167C-L169C
Plasmid#162587PurposeExpresses norovirus GI.1 VP1 protein with mutations N167C-L169C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 167 changed to Cysteine and Leucine 16…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-ADAP1
Plasmid#163906PurposeFull length mouse ADAP1 with N terminal fluorescent tag for purification from insect cellsDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-CD52-bglpA
Plasmid#89704PurposeHuman CD52 expression plasmid with short polyADepositorAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
Plasmid#79030PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
TagsOneSTrEP-FLAGExpressionInsectMutationdeleted amino acid 294-515 from frican green monk…PromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSSRB070_pAC8-hsCRBN
Plasmid#218789PurposeInsect cell expression vector for FLAG-TEV-Spy-hsCRBNDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin G13R
Plasmid#60615PurposeEncodes YFP and NLS tagged beta-actin with the G13R depolymerization mutationDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
miABE
Plasmid#205412PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6-_RNA*-pCAG-bpNLS-TadA8e(V106W)-32aa-OgeuIscB*(D61A)-GS-bpNLS-GS-TadA8e(V106W)-bpNLS-bGH polyA-pCMV-mCherry-AmpR
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET15b-His-3C-irisin
Plasmid#122612PurposeExpresses in E. coli: human irisin with Nt histag and 3C protease site for cleavageDepositorInsertirisin (ectodomain of FNDC5) (Fndc5 Rat, Bovine, Mouse, Human)
TagsNt: histag-3C protease siteExpressionBacterialPromoterT7 polymeraseAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin S14C
Plasmid#60614PurposeEncodes YFP and NLS tagged beta-actin with the S14C polymerization mutationDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-Flag-FANCD2
Plasmid#134904Purposecodon optimized expression and purification of human FANCD2 in insect cells using baculovirusDepositorInsertFANCD2 (FANCD2 Human)
TagsFlagExpressionInsectMutationfully synthetic, codon optimized for insect expre…PromoterpolyhedronAvailable SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKE12-ISceI-fabp10a:loxP-BFP-loxP-Xla.Ctnnb1
Plasmid#198240PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter drives expression of activated β-catenin preceded by a blue fluorescent protein (BFP)-STOP cassette flanked by loxP sitesDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF155/SMARCC1-His
Plasmid#177863PurposeTransfer vector to generate recombinant baculovirus expressing BAF155/SMARCC1-HisDepositorInsertSMARCC1 (SMARCC1 Human)
TagsHis and His tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-msfGFPΔN12
Plasmid#231550PurposeMammalian expression of Affimer6 fused to N-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244)
Plasmid#160566PurposeGBoligomers for the position [3_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (E3-E4-En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVNP2.0-SpCas9
Plasmid#206880PurposeExpresses FLAG-tagged SpCas9 fused to the N-terminus of Gag/GagPol harbouring an intervening phospholipase C-δ1 pleckstrin homology (PH) domainDepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRAvailable SinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastbac1-GST-hUSP7
Plasmid#63573PurposeExpression of synthetic human USP7 tagged with GSTDepositorInsertUSP7 (USP7 Synthetic, Human)
TagsGSTExpressionInsectMutationSynthetic based on human protein sequence (please…PromoterPolyhedrinAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-sfCherry2ΔN12
Plasmid#231551PurposeMammalian expression of Affimer6 fused to N-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagssfCherry2ExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.JARID2
Plasmid#125166PurposeExpresses human JARID2 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXs-LN2
Plasmid#188235PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OS
Plasmid#136576PurposeDox-inducible polycistronic lentiviral vector expressing mouse Oct4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac (GST-SNAP-Shp2)
Plasmid#177897PurposeBaculo expression of GST tag fused to SNAP tag and human Shp2DepositorInsertShp2 (PTPN11 Human)
TagsTEV-GST-PreScission cut site-SNAP tagExpressionInsectPromoterPolyhedrinAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC8 H143A
Plasmid#224344PurposeExpresses human KDAC8 (HDAC8) H143A in insect cellsDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionInsectMutationHistidine 143 mutated to alaninePromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSCV-miRE-shRNA IFT88-PGK-neo-IRES-GFP
Plasmid#73576PurposeMammalian retroviral expression vectorDepositorAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2-mt2*
Plasmid#220246PurposeExpresses an EZH2 mutant for knockout/rescue experiments in mammalian cells.DepositorInsertEZH2 mt 2* (EZH2 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPRKKKR494-499NAAIRSPromoterEF-1αAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_1-pTRNA-scf 2.1 (GB2603)
Plasmid#160568PurposetRNA and scaffold 2.1 scRNA aptamer Ms2 for the assembly of GBoligomers for a single position of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_1-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_n-1] (GB1210)
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-WNV_NS2B-GS-NS3
Plasmid#203475PurposeExpresses WNV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-mEGFP-pp4640
Plasmid#191846PurposeExpresses Salmon Alphavirus polyprotein with mEGFP N-terminal fusionDepositorInsertmEGFP-pp4640
TagsmEGFPExpressionMammalianMutationmEGFP fusion in Nterminal, some silent point muta…PromoterCMVAvailable SinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXs-LN
Plasmid#188231PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorUseRetroviralExpressionMammalianAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp15 (SARS-CoV-2)
Plasmid#169166PurposeBaculoviral transfer vector for the expression of SARS-CoV-2 nsp15 in insect cellsDepositorInsert3xFlag-6His-nsp15 (ORF1ab Synthetic, SARS-CoV-2)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET45b-tsr(B/X) (6X-His-Dm-Cofilin)
Plasmid#128278PurposeExpresses Drosophila melanogaster Cofilin (Twinstar) in bacterial cell cultureDepositorInserttwinstar (tsr) (tsr Fly)
Tags6X Histidine tagExpressionBacterialMutationMet1 changed to Pro1; Cys77 silent basepair mutat…PromoterT7Available SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
vipr1_L (OZ559)
Plasmid#28084DepositorInsertZinc finger array targeting vipr1 (LOC100334247 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
vipr1_R (OZ560)
Plasmid#28085DepositorInsertZinc finger array targeting vipr1 (LOC100334247 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
CD44v-EC-His (pcDNA3)
Plasmid#238418PurposeExpresses the polyhistidine-tagged extracellular region of CD44v (CD44v-EC-His)DepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-Cyclin B1 ND
Plasmid#234706Purposeallows tethering of non degradable (ND) cyclin B1 protein to lacO repeats in specific chromatin lociDepositorAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC7 CD
Plasmid#224345PurposeExpresses human KDAC7 (HDAC7) catalytic domain in insect cellsDepositorInsertKDAC7 (HDAC7 Human)
TagsTEV-cleavable His6ExpressionInsectMutationOnly includes residues 521-942 (catalytic domain).PromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8ΔChromo
Plasmid#224708PurposeExpresses a human CBX8 truncation (deletion of the chromodomain) in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tagDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.mEGFP-CBX8
Plasmid#224710PurposeExpresses N-terminal hexahistidine-tagged human CBX8 in insect cells, with a monomeric variant EGFP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8
Plasmid#224707PurposeExpresses human CBX8 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mFzd4-opt(40-537)-9xHis_pFastBac1
Plasmid#216378PurposeBaculovirus transfer vector to express FLAG-tagged mouse Fzd4 (codon-optimized for insect cell expression)DepositorInsertFrizzled-4 (Fzd4 Mouse)
UseBaculovirusTagsHA signal sequence-FLAGExpressionInsectPromoterPolyhedrinAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-POWV_NS2B-GS-NS3
Plasmid#203471PurposeExpresses POWV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-LGTV_NS2B-GS-NS3
Plasmid#203468PurposeExpresses LGTV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-ZIKV_NS2B-GS-NS3
Plasmid#203477PurposeExpresses ZIKV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only